Incidental Mutation 'R5219:Ppp3cb'
ID402242
Institutional Source Beutler Lab
Gene Symbol Ppp3cb
Ensembl Gene ENSMUSG00000021816
Gene Nameprotein phosphatase 3, catalytic subunit, beta isoform
SynonymsCalnb, PP2BA beta, Cnab, CnAbeta, 1110063J16Rik
MMRRC Submission 042792-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5219 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20499364-20546573 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 20528195 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 162 (C162*)
Ref Sequence ENSEMBL: ENSMUSP00000125582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022355] [ENSMUST00000159027] [ENSMUST00000161445] [ENSMUST00000161989]
Predicted Effect probably null
Transcript: ENSMUST00000022355
AA Change: C162*
SMART Domains Protein: ENSMUSP00000022355
Gene: ENSMUSG00000021816
AA Change: C162*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159027
AA Change: C162*
SMART Domains Protein: ENSMUSP00000125722
Gene: ENSMUSG00000021816
AA Change: C162*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161332
Predicted Effect probably null
Transcript: ENSMUST00000161445
AA Change: C162*
SMART Domains Protein: ENSMUSP00000125630
Gene: ENSMUSG00000021816
AA Change: C162*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161989
AA Change: C162*
SMART Domains Protein: ENSMUSP00000125582
Gene: ENSMUSG00000021816
AA Change: C162*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
low complexity region 487 497 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (68/70)
MGI Phenotype PHENOTYPE: Homozygous null mice have small hearts and thymi, and reduced body weight. Cardiac function is normal, but mice lack a cardiac hypertrophic response to pressure overload, angiotensin II, or isopreteronol. Thymi are hypoplastic, with abnormal T cell development and reduced numbers of T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700063H04Rik A G 6: 122,392,340 noncoding transcript Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
9330182L06Rik G T 5: 9,461,486 W949C probably damaging Het
A2m A G 6: 121,676,950 H1414R possibly damaging Het
A530064D06Rik G T 17: 48,163,350 D154E possibly damaging Het
Adam34 C T 8: 43,651,424 D395N probably benign Het
Agl A G 3: 116,778,721 V195A possibly damaging Het
Aip T C 19: 4,115,180 I230V probably benign Het
Akap10 A C 11: 61,922,791 S43A probably benign Het
Ap3d1 T C 10: 80,709,817 E1026G probably benign Het
Arid5b T A 10: 68,278,110 K32N probably benign Het
Atp6v0a2 C A 5: 124,713,185 N477K probably damaging Het
Atr A C 9: 95,881,238 I1062L probably damaging Het
Ces2h T C 8: 105,016,646 V171A probably damaging Het
Cnot2 A G 10: 116,506,310 probably null Het
Cpne3 A T 4: 19,526,366 L391H probably damaging Het
Ctdp1 A G 18: 80,447,460 L715P probably damaging Het
Dcxr T C 11: 120,725,488 probably benign Het
Dhtkd1 C T 2: 5,914,816 A585T probably benign Het
Fcgbp G A 7: 28,104,085 A1705T probably damaging Het
Galr1 A T 18: 82,393,985 V252D probably damaging Het
Gm11677 A G 11: 111,725,399 noncoding transcript Het
Gp6 A G 7: 4,368,999 V252A possibly damaging Het
Inpp4b T C 8: 81,884,156 V176A probably benign Het
Irx2 G C 13: 72,631,301 A235P probably damaging Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lars A T 18: 42,234,720 V431E probably benign Het
Lmntd2 T C 7: 141,211,474 probably null Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Ltbp4 A T 7: 27,327,321 W500R probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Nadk A G 4: 155,584,254 I127M probably benign Het
Nxph1 T A 6: 9,247,765 Y245* probably null Het
Olfr1246 C T 2: 89,590,702 V138I probably benign Het
Olfr827 T A 10: 130,210,924 T69S possibly damaging Het
Olfr831-ps1 T C 9: 18,932,694 probably benign Het
Olfr954 G T 9: 39,462,267 V276L probably benign Het
Orc1 T C 4: 108,590,769 F71S probably damaging Het
Pccb A T 9: 100,985,209 Y404* probably null Het
Pde2a A C 7: 101,504,604 I460L probably damaging Het
Prickle2 T C 6: 92,376,530 S652G probably benign Het
Prss38 A G 11: 59,375,483 probably benign Het
Rcor3 T A 1: 192,137,513 probably benign Het
Rgp1 C T 4: 43,579,440 A16V probably damaging Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scnn1g T A 7: 121,766,266 Y514N probably damaging Het
Sephs1 A G 2: 4,891,690 D134G probably benign Het
Slc38a3 A G 9: 107,651,912 probably benign Het
Slc6a1 A T 6: 114,310,221 M388L probably benign Het
Ssbp3 A T 4: 107,047,458 N350I probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Sult1e1 A T 5: 87,578,586 I223N probably damaging Het
Tcf20 C A 15: 82,856,381 G290C probably damaging Het
Tekt2 G T 4: 126,322,264 T412K possibly damaging Het
Trabd2b A G 4: 114,602,810 T382A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 C A 4: 139,477,232 Y4818* probably null Het
Vmn1r204 A T 13: 22,556,899 R233S probably damaging Het
Vmn1r86 A G 7: 13,102,455 Y165H probably damaging Het
Yaf2 A C 15: 93,285,474 C152G probably benign Het
Zfp804b A T 5: 6,770,703 F751I probably benign Het
Other mutations in Ppp3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ppp3cb APN 14 20528250 missense probably benign 0.00
IGL00844:Ppp3cb APN 14 20531686 missense possibly damaging 0.95
IGL01859:Ppp3cb APN 14 20509449 missense probably damaging 0.99
IGL02490:Ppp3cb APN 14 20531658 critical splice donor site probably null
IGL02546:Ppp3cb APN 14 20501554 missense probably benign 0.00
IGL02555:Ppp3cb APN 14 20530953 missense probably damaging 1.00
IGL02724:Ppp3cb APN 14 20523577 splice site probably null
IGL02944:Ppp3cb APN 14 20528235 missense probably damaging 1.00
IGL03072:Ppp3cb APN 14 20531725 missense probably damaging 1.00
IGL03301:Ppp3cb APN 14 20523984 missense probably damaging 0.99
Copacabana UTSW 14 20530942 critical splice donor site probably null
eden_express UTSW 14 20528195 nonsense probably null
everglades UTSW 14 20530948 missense probably damaging 1.00
Havana UTSW 14 20531752 missense possibly damaging 0.85
justinian UTSW 14 20508543 missense possibly damaging 0.73
Prokopios UTSW 14 20520652 missense probably benign 0.05
Redwood UTSW 14 20509440 missense probably damaging 1.00
R0026:Ppp3cb UTSW 14 20531768 missense probably benign 0.00
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0218:Ppp3cb UTSW 14 20523976 missense probably damaging 0.99
R0479:Ppp3cb UTSW 14 20503241 unclassified probably null
R1013:Ppp3cb UTSW 14 20524004 missense probably benign
R1061:Ppp3cb UTSW 14 20508614 splice site probably null
R1498:Ppp3cb UTSW 14 20509499 critical splice acceptor site probably null
R1508:Ppp3cb UTSW 14 20524424 missense probably damaging 0.99
R1719:Ppp3cb UTSW 14 20524063 missense probably benign 0.05
R1799:Ppp3cb UTSW 14 20524472 missense possibly damaging 0.81
R1883:Ppp3cb UTSW 14 20523845 missense possibly damaging 0.66
R2082:Ppp3cb UTSW 14 20508678 missense possibly damaging 0.66
R2176:Ppp3cb UTSW 14 20520652 missense probably benign 0.05
R3021:Ppp3cb UTSW 14 20523853 nonsense probably null
R3726:Ppp3cb UTSW 14 20530942 critical splice donor site probably null
R4085:Ppp3cb UTSW 14 20508543 missense possibly damaging 0.73
R4328:Ppp3cb UTSW 14 20530948 missense probably damaging 1.00
R4509:Ppp3cb UTSW 14 20515501 intron probably benign
R4600:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4601:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4603:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4610:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4611:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4694:Ppp3cb UTSW 14 20501515 missense probably benign 0.00
R4749:Ppp3cb UTSW 14 20524062 missense probably damaging 1.00
R4866:Ppp3cb UTSW 14 20523843 missense probably damaging 1.00
R4911:Ppp3cb UTSW 14 20509440 missense probably damaging 1.00
R5105:Ppp3cb UTSW 14 20509422 missense possibly damaging 0.84
R5586:Ppp3cb UTSW 14 20520690 splice site probably benign
R5740:Ppp3cb UTSW 14 20501596 missense possibly damaging 0.76
R6649:Ppp3cb UTSW 14 20531026 missense probably damaging 1.00
R7362:Ppp3cb UTSW 14 20523651 missense probably benign 0.00
R7493:Ppp3cb UTSW 14 20508551 missense probably benign 0.01
R8291:Ppp3cb UTSW 14 20523594 missense possibly damaging 0.89
Z1177:Ppp3cb UTSW 14 20508518 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTCAAAAGTATACACTGGTGGTC -3'
(R):5'- AGGAAAGAAGCCATTTTGTTAGGC -3'

Sequencing Primer
(F):5'- ATACACTGGTGGTCATGGAATG -3'
(R):5'- GAAAGTTCACTGGAAACGT -3'
Posted On2016-07-22