Incidental Mutation 'R5220:Slc10a5'
ID402256
Institutional Source Beutler Lab
Gene Symbol Slc10a5
Ensembl Gene ENSMUSG00000058921
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 5
SynonymsLOC241877
MMRRC Submission 042793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5220 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location10331734-10335656 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 10335088 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 171 (R171*)
Ref Sequence ENSEMBL: ENSMUSP00000077808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037839] [ENSMUST00000065938] [ENSMUST00000078748] [ENSMUST00000118410] [ENSMUST00000128912] [ENSMUST00000191670] [ENSMUST00000192603]
Predicted Effect probably benign
Transcript: ENSMUST00000037839
SMART Domains Protein: ENSMUSP00000037459
Gene: ENSMUSG00000039795

DomainStartEndE-ValueType
ZnF_AN1 10 49 1.4e-8 SMART
ZnF_AN1 64 103 2.64e-4 SMART
low complexity region 121 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065938
SMART Domains Protein: ENSMUSP00000068174
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 1.5e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078748
AA Change: R171*
SMART Domains Protein: ENSMUSP00000077808
Gene: ENSMUSG00000058921
AA Change: R171*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SBF 144 328 1.1e-34 PFAM
transmembrane domain 336 358 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118410
SMART Domains Protein: ENSMUSP00000113860
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 7.7e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125734
Predicted Effect probably benign
Transcript: ENSMUST00000128912
SMART Domains Protein: ENSMUSP00000116088
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 19 90 4.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191670
SMART Domains Protein: ENSMUSP00000141345
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 180 4.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192603
SMART Domains Protein: ENSMUSP00000141735
Gene: ENSMUSG00000103392

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,088,297 E250G probably damaging Het
Adgra1 A G 7: 139,875,596 N380S probably benign Het
Ap3d1 G A 10: 80,727,167 P160L probably damaging Het
Atg9a C T 1: 75,185,728 V505M probably damaging Het
Chsy3 A T 18: 59,410,030 I747F probably damaging Het
Clec2g A G 6: 128,981,306 S100G probably benign Het
Cmya5 G T 13: 93,092,296 P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 W445R possibly damaging Het
Espl1 T A 15: 102,298,577 L159M probably benign Het
Fam126a A C 5: 23,965,222 S376R possibly damaging Het
Fbxw8 T C 5: 118,095,711 D285G possibly damaging Het
Fras1 C T 5: 96,768,363 R3419W probably damaging Het
Galc T A 12: 98,231,413 probably null Het
Ghdc T C 11: 100,769,717 E110G probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
H2-T24 T C 17: 36,014,670 T309A probably benign Het
Helb A C 10: 120,101,486 F618V probably damaging Het
Ifi211 A G 1: 173,907,696 F56L probably damaging Het
Kntc1 T C 5: 123,812,097 F1988L probably damaging Het
Mapk13 G A 17: 28,778,491 S361N probably benign Het
Mapk3 A G 7: 126,764,236 I146V probably benign Het
Megf6 G A 4: 154,253,838 probably null Het
Mug1 G T 6: 121,861,133 V441F probably benign Het
Mymk A G 2: 27,062,214 S173P probably benign Het
Nox4 A G 7: 87,374,408 T501A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 C A 4: 43,854,624 S105Y possibly damaging Het
Olfr666 T C 7: 104,892,897 T244A possibly damaging Het
Prkcb C A 7: 122,289,455 H37Q probably damaging Het
Rabggtb A G 3: 153,909,387 F189L probably damaging Het
Setd1b T C 5: 123,143,408 I75T unknown Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Slc1a5 T A 7: 16,793,834 W352R probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
St8sia4 A G 1: 95,627,735 M190T probably damaging Het
Tmeff2 A G 1: 50,979,317 M153V probably benign Het
Trappc12 T C 12: 28,746,697 T279A probably damaging Het
Ubn1 G T 16: 5,077,954 A955S probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Vrk1 T A 12: 106,073,606 probably null Het
Zdhhc25 T A 15: 88,601,162 Y233* probably null Het
Zfp109 A G 7: 24,228,754 V418A probably benign Het
Other mutations in Slc10a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Slc10a5 APN 3 10335309 missense probably benign 0.05
IGL01785:Slc10a5 APN 3 10335199 missense probably benign 0.00
IGL01823:Slc10a5 APN 3 10334514 missense possibly damaging 0.93
IGL01915:Slc10a5 APN 3 10335520 missense probably damaging 0.98
IGL02522:Slc10a5 APN 3 10335121 missense probably benign 0.09
IGL02721:Slc10a5 APN 3 10334535 missense probably benign 0.01
PIT4382001:Slc10a5 UTSW 3 10335447 missense probably benign
R0558:Slc10a5 UTSW 3 10335117 missense probably damaging 1.00
R0961:Slc10a5 UTSW 3 10334424 missense probably benign 0.00
R1747:Slc10a5 UTSW 3 10335391 missense probably benign 0.04
R1889:Slc10a5 UTSW 3 10335490 missense probably benign 0.33
R2130:Slc10a5 UTSW 3 10335218 missense probably benign
R2171:Slc10a5 UTSW 3 10335282 missense possibly damaging 0.59
R2970:Slc10a5 UTSW 3 10335067 missense probably damaging 1.00
R2972:Slc10a5 UTSW 3 10334457 missense probably damaging 0.98
R2973:Slc10a5 UTSW 3 10334457 missense probably damaging 0.98
R4241:Slc10a5 UTSW 3 10335460 missense probably damaging 1.00
R4700:Slc10a5 UTSW 3 10335299 missense probably damaging 1.00
R4700:Slc10a5 UTSW 3 10335300 missense probably damaging 1.00
R4790:Slc10a5 UTSW 3 10335036 missense probably damaging 1.00
R4834:Slc10a5 UTSW 3 10334799 missense probably damaging 0.97
R4891:Slc10a5 UTSW 3 10334625 missense possibly damaging 0.79
R5548:Slc10a5 UTSW 3 10334317 missense probably benign
R5748:Slc10a5 UTSW 3 10335331 missense probably benign 0.00
R6573:Slc10a5 UTSW 3 10335050 missense probably damaging 1.00
R6909:Slc10a5 UTSW 3 10335595 missense possibly damaging 0.90
R7355:Slc10a5 UTSW 3 10334315 nonsense probably null
R7807:Slc10a5 UTSW 3 10335469 missense probably benign 0.00
R7866:Slc10a5 UTSW 3 10334472 missense probably damaging 0.99
R7949:Slc10a5 UTSW 3 10334472 missense probably damaging 0.99
Z1176:Slc10a5 UTSW 3 10334487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAAGTCATCAAAATGGCC -3'
(R):5'- GGTAGGCAAACAACACTCATCG -3'

Sequencing Primer
(F):5'- TGGCCAAAGTGACATCCCCTTC -3'
(R):5'- TCATCGACGAGCTAAAGAATGTC -3'
Posted On2016-07-22