Incidental Mutation 'R0415:Sfswap'
ID40226
Institutional Source Beutler Lab
Gene Symbol Sfswap
Ensembl Gene ENSMUSG00000029439
Gene Namesplicing factor SWAP
SynonymsSfrs8, 6330437E22Rik, 1190005N23Rik
MMRRC Submission 038617-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0415 (G1)
Quality Score149
Status Validated
Chromosome5
Chromosomal Location129501221-129571384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129504126 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 121 (D121V)
Ref Sequence ENSEMBL: ENSMUSP00000062413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698] [ENSMUST00000200500]
Predicted Effect probably damaging
Transcript: ENSMUST00000053737
AA Change: D121V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: D121V

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 157 1.15e-57 SMART
low complexity region 160 170 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
SWAP 209 262 3.94e-19 SMART
low complexity region 286 293 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
low complexity region 397 441 N/A INTRINSIC
SWAP 456 507 9.55e-18 SMART
low complexity region 513 532 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 598 607 N/A INTRINSIC
coiled coil region 631 686 N/A INTRINSIC
low complexity region 741 788 N/A INTRINSIC
low complexity region 797 821 N/A INTRINSIC
low complexity region 840 865 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
low complexity region 889 905 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196147
Predicted Effect probably benign
Transcript: ENSMUST00000196698
SMART Domains Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 121 1.8e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199925
Predicted Effect probably benign
Transcript: ENSMUST00000200500
SMART Domains Protein: ENSMUSP00000143351
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200662
Meta Mutation Damage Score 0.6520 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 23,831,050 noncoding transcript Het
Acox2 A G 14: 8,243,835 probably benign Het
Adgb T C 10: 10,431,067 probably null Het
Adgra3 C A 5: 49,961,757 probably benign Het
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ahnak A G 19: 9,012,871 probably benign Het
Anapc2 A G 2: 25,278,325 T159A probably damaging Het
Arfgef3 A G 10: 18,613,127 probably benign Het
Atf7ip C T 6: 136,560,012 S81L possibly damaging Het
Cacna1i A G 15: 80,368,830 probably benign Het
Camk1 A T 6: 113,341,891 Y20* probably null Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
Cd109 T A 9: 78,712,615 S1380T probably benign Het
Cfap57 A T 4: 118,569,431 L1107Q possibly damaging Het
Col6a4 C T 9: 106,075,080 V540I probably damaging Het
Cst9 T A 2: 148,838,442 probably benign Het
Cul5 C T 9: 53,667,070 V73I probably benign Het
Cxcl16 T A 11: 70,458,748 K84* probably null Het
Cyp2c29 T C 19: 39,329,095 probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dip2c C T 13: 9,568,289 probably benign Het
Dis3 A T 14: 99,087,456 I513N probably damaging Het
Dnajc16 A T 4: 141,789,048 L3* probably null Het
Dopey1 T A 9: 86,506,502 L480M probably damaging Het
Eml6 A G 11: 29,749,392 V1787A possibly damaging Het
Etnk1 A G 6: 143,180,774 N115S probably damaging Het
Fryl T C 5: 73,098,414 Y758C probably damaging Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Ggnbp2 A C 11: 84,833,225 probably benign Het
Gm7137 A G 10: 77,788,173 probably benign Het
Gstm2 T A 3: 107,984,006 Q132L probably benign Het
Habp2 T C 19: 56,317,717 probably benign Het
Hectd2 T C 19: 36,584,884 probably benign Het
Htr6 A G 4: 139,062,081 I291T possibly damaging Het
Ighg2c T C 12: 113,287,910 D199G unknown Het
Itih2 A G 2: 10,105,615 probably benign Het
Kcnab2 A G 4: 152,395,136 F248S probably benign Het
Kcnc4 T C 3: 107,445,433 K610E probably damaging Het
Kcnk16 T A 14: 20,262,975 probably null Het
Kndc1 C T 7: 139,930,124 T1293I probably damaging Het
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Lrrc8d T C 5: 105,811,865 L47P probably damaging Het
Lyst T C 13: 13,711,610 probably benign Het
Macrod2 G A 2: 142,210,145 probably null Het
Micalcl C T 7: 112,381,028 R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,841,339 probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nup205 T C 6: 35,214,634 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Olfr229 A G 9: 39,909,983 Y60C probably damaging Het
Olfr78 C T 7: 102,742,087 M305I probably benign Het
Olfr893 A T 9: 38,209,973 M305L probably benign Het
Pard3 G A 8: 127,610,566 G1221D probably damaging Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Pcsk6 C T 7: 66,033,874 R746C probably damaging Het
Pif1 G A 9: 65,588,051 C81Y probably benign Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plcd4 C A 1: 74,552,097 S217Y probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Het
Polr2k A G 15: 36,175,456 Y45C probably damaging Het
Pqlc3 C A 12: 16,997,710 probably benign Het
Prex1 A G 2: 166,586,699 probably benign Het
Pth2r A G 1: 65,388,439 M424V probably benign Het
Pygm A G 19: 6,391,366 R464G probably benign Het
Rad51c A G 11: 87,397,655 L234P probably damaging Het
Rnf145 A G 11: 44,525,138 Y60C probably damaging Het
Rnf167 T C 11: 70,649,699 I135T probably damaging Het
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Het
Selenbp1 T C 3: 94,936,913 V27A possibly damaging Het
Selenof T G 3: 144,577,692 L14R probably damaging Het
Slc25a34 C A 4: 141,620,469 M300I possibly damaging Het
Slc34a3 T G 2: 25,229,110 T583P probably benign Het
Smg1 C A 7: 118,182,468 A1199S probably benign Het
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Sptbn1 A C 11: 30,149,576 N229K probably damaging Het
Sult2b1 A G 7: 45,730,092 probably benign Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem132c A G 5: 127,563,705 E980G probably damaging Het
Tmem247 G T 17: 86,922,322 C197F probably damaging Het
Tmem251 T A 12: 102,744,876 Y119* probably null Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Het
Tmprss13 A G 9: 45,337,132 probably null Het
Trove2 G T 1: 143,760,075 N444K probably benign Het
Ubr5 T C 15: 37,972,980 T2626A probably damaging Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Het
Vmn1r22 G T 6: 57,900,332 T220K probably benign Het
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Vmn2r74 A C 7: 85,961,410 C25G probably damaging Het
Xndc1 T C 7: 102,080,616 probably benign Het
Zfp282 A G 6: 47,897,881 D340G probably damaging Het
Zfp282 T A 6: 47,905,053 I558N possibly damaging Het
Zfp316 T A 5: 143,264,491 T56S unknown Het
Zfp345 A G 2: 150,474,559 probably benign Het
Other mutations in Sfswap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Sfswap APN 5 129513233 missense probably damaging 1.00
IGL02064:Sfswap APN 5 129560796 missense probably benign 0.17
IGL02083:Sfswap APN 5 129539791 missense probably benign
IGL02378:Sfswap APN 5 129539604 missense probably damaging 1.00
FR4340:Sfswap UTSW 5 129569751 unclassified probably benign
FR4342:Sfswap UTSW 5 129569757 unclassified probably benign
FR4449:Sfswap UTSW 5 129569748 unclassified probably benign
FR4449:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569755 unclassified probably benign
FR4737:Sfswap UTSW 5 129569756 unclassified probably benign
FR4976:Sfswap UTSW 5 129569751 unclassified probably benign
I1329:Sfswap UTSW 5 129507137 unclassified probably benign
P0033:Sfswap UTSW 5 129539755 missense possibly damaging 0.60
R0184:Sfswap UTSW 5 129507189 missense probably damaging 0.97
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0414:Sfswap UTSW 5 129504051 missense possibly damaging 0.83
R0570:Sfswap UTSW 5 129503978 splice site probably benign
R1018:Sfswap UTSW 5 129554576 missense possibly damaging 0.91
R1173:Sfswap UTSW 5 129507143 critical splice acceptor site probably null
R1298:Sfswap UTSW 5 129541378 missense probably benign 0.14
R1723:Sfswap UTSW 5 129539694 missense probably benign
R1783:Sfswap UTSW 5 129513240 missense possibly damaging 0.92
R1828:Sfswap UTSW 5 129513084 missense probably damaging 1.00
R1879:Sfswap UTSW 5 129541328 missense probably benign 0.01
R2078:Sfswap UTSW 5 129516107 missense possibly damaging 0.81
R2349:Sfswap UTSW 5 129569738 missense possibly damaging 0.87
R3757:Sfswap UTSW 5 129513234 missense probably damaging 1.00
R4093:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4094:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4095:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4785:Sfswap UTSW 5 129513083 missense probably damaging 1.00
R5139:Sfswap UTSW 5 129571009 missense possibly damaging 0.73
R5355:Sfswap UTSW 5 129539746 missense probably benign 0.09
R5481:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5600:Sfswap UTSW 5 129513158 missense probably damaging 1.00
R5686:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5906:Sfswap UTSW 5 129542043 missense probably benign 0.22
R6332:Sfswap UTSW 5 129571041 missense possibly damaging 0.91
R6738:Sfswap UTSW 5 129541441 missense probably damaging 0.98
R6743:Sfswap UTSW 5 129550819 nonsense probably null
R7371:Sfswap UTSW 5 129543241 missense probably benign 0.01
R7747:Sfswap UTSW 5 129550593 intron probably null
RF003:Sfswap UTSW 5 129569764 unclassified probably benign
RF042:Sfswap UTSW 5 129569743 unclassified probably benign
RF049:Sfswap UTSW 5 129569744 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGGGTGTAGACTTCCCTCCAGTG -3'
(R):5'- CTGCCCTCAAAAGCTGGGAAAATTC -3'

Sequencing Primer
(F):5'- AGTGACCAGCCTGTTCACATTAC -3'
(R):5'- TATCCTGAGGTCCTCTCAGAACG -3'
Posted On2013-05-23