Incidental Mutation 'R5220:Fam126a'
ID402261
Institutional Source Beutler Lab
Gene Symbol Fam126a
Ensembl Gene ENSMUSG00000028995
Gene Namefamily with sequence similarity 126, member A
Synonyms
MMRRC Submission 042793-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R5220 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location23915276-24030690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23965222 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 376 (S376R)
Ref Sequence ENSEMBL: ENSMUSP00000030849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030849] [ENSMUST00000101513] [ENSMUST00000115109] [ENSMUST00000197617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030849
AA Change: S376R

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030849
Gene: ENSMUSG00000028995
AA Change: S376R

DomainStartEndE-ValueType
Pfam:Hyccin 22 330 2.7e-133 PFAM
low complexity region 353 373 N/A INTRINSIC
low complexity region 415 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101513
SMART Domains Protein: ENSMUSP00000099050
Gene: ENSMUSG00000028995

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 8e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115109
SMART Domains Protein: ENSMUSP00000110761
Gene: ENSMUSG00000028995

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 2.2e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197617
SMART Domains Protein: ENSMUSP00000143784
Gene: ENSMUSG00000028995

DomainStartEndE-ValueType
Pfam:Hyccin 1 248 1.7e-100 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may play a part in the beta-catenin/Lef signaling pathway. Expression of this gene is down-regulated by beta-catenin. Defects in this gene are a cause of hypomyelination with congenital cataract (HCC). [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,088,297 E250G probably damaging Het
Adgra1 A G 7: 139,875,596 N380S probably benign Het
Ap3d1 G A 10: 80,727,167 P160L probably damaging Het
Atg9a C T 1: 75,185,728 V505M probably damaging Het
Chsy3 A T 18: 59,410,030 I747F probably damaging Het
Clec2g A G 6: 128,981,306 S100G probably benign Het
Cmya5 G T 13: 93,092,296 P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 W445R possibly damaging Het
Espl1 T A 15: 102,298,577 L159M probably benign Het
Fbxw8 T C 5: 118,095,711 D285G possibly damaging Het
Fras1 C T 5: 96,768,363 R3419W probably damaging Het
Galc T A 12: 98,231,413 probably null Het
Ghdc T C 11: 100,769,717 E110G probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
H2-T24 T C 17: 36,014,670 T309A probably benign Het
Helb A C 10: 120,101,486 F618V probably damaging Het
Ifi211 A G 1: 173,907,696 F56L probably damaging Het
Kntc1 T C 5: 123,812,097 F1988L probably damaging Het
Mapk13 G A 17: 28,778,491 S361N probably benign Het
Mapk3 A G 7: 126,764,236 I146V probably benign Het
Megf6 G A 4: 154,253,838 probably null Het
Mug1 G T 6: 121,861,133 V441F probably benign Het
Mymk A G 2: 27,062,214 S173P probably benign Het
Nox4 A G 7: 87,374,408 T501A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 C A 4: 43,854,624 S105Y possibly damaging Het
Olfr666 T C 7: 104,892,897 T244A possibly damaging Het
Prkcb C A 7: 122,289,455 H37Q probably damaging Het
Rabggtb A G 3: 153,909,387 F189L probably damaging Het
Setd1b T C 5: 123,143,408 I75T unknown Het
Slc10a5 T A 3: 10,335,088 R171* probably null Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Slc1a5 T A 7: 16,793,834 W352R probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
St8sia4 A G 1: 95,627,735 M190T probably damaging Het
Tmeff2 A G 1: 50,979,317 M153V probably benign Het
Trappc12 T C 12: 28,746,697 T279A probably damaging Het
Ubn1 G T 16: 5,077,954 A955S probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Vrk1 T A 12: 106,073,606 probably null Het
Zdhhc25 T A 15: 88,601,162 Y233* probably null Het
Zfp109 A G 7: 24,228,754 V418A probably benign Het
Other mutations in Fam126a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Fam126a APN 5 23985845 splice site probably benign
IGL03365:Fam126a APN 5 23983160 missense probably benign 0.30
Dropsy UTSW 5 23999958 missense probably damaging 0.99
R0070:Fam126a UTSW 5 23964999 missense probably damaging 1.00
R0070:Fam126a UTSW 5 23964999 missense probably damaging 1.00
R0616:Fam126a UTSW 5 23986772 missense probably damaging 0.99
R0645:Fam126a UTSW 5 23979508 missense probably damaging 1.00
R1364:Fam126a UTSW 5 23965353 missense probably benign
R1462:Fam126a UTSW 5 23985732 splice site probably benign
R1544:Fam126a UTSW 5 23965141 missense probably benign 0.00
R1670:Fam126a UTSW 5 23999991 start codon destroyed possibly damaging 0.95
R1796:Fam126a UTSW 5 23986151 missense probably damaging 1.00
R4433:Fam126a UTSW 5 23979581 missense possibly damaging 0.77
R4523:Fam126a UTSW 5 23965122 missense probably benign 0.01
R5453:Fam126a UTSW 5 23987879 splice site probably null
R5694:Fam126a UTSW 5 23991796 missense probably damaging 1.00
R5703:Fam126a UTSW 5 23980579 splice site probably null
R6144:Fam126a UTSW 5 23966369 missense possibly damaging 0.45
R6547:Fam126a UTSW 5 23965100 missense probably benign 0.04
R6579:Fam126a UTSW 5 23966383 missense possibly damaging 0.77
R6906:Fam126a UTSW 5 23999958 missense probably damaging 0.99
R6924:Fam126a UTSW 5 23986135 splice site probably null
R6959:Fam126a UTSW 5 23991756 missense possibly damaging 0.84
R7068:Fam126a UTSW 5 23964795 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACTGGCTGGAGGTTAAGGTCAG -3'
(R):5'- AGTGGGGTAGTTTACAGCATGC -3'

Sequencing Primer
(F):5'- AGGTTAAGGTCAGTCTCTTCAGAG -3'
(R):5'- CAGCATGCTTGTGGTTTAATATATTC -3'
Posted On2016-07-22