Incidental Mutation 'R5220:Fbxw8'
ID402263
Institutional Source Beutler Lab
Gene Symbol Fbxw8
Ensembl Gene ENSMUSG00000032867
Gene NameF-box and WD-40 domain protein 8
SynonymsFbx29, FBW6, FBXO29, 4930438M06Rik, FBW8
MMRRC Submission 042793-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R5220 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location118064965-118155464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118095711 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 285 (D285G)
Ref Sequence ENSEMBL: ENSMUSP00000047012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049474]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049474
AA Change: D285G

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047012
Gene: ENSMUSG00000032867
AA Change: D285G

DomainStartEndE-ValueType
low complexity region 16 39 N/A INTRINSIC
low complexity region 51 75 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
FBOX 119 159 5e-5 SMART
WD40 198 236 6.16e0 SMART
WD40 248 285 7.1e1 SMART
WD40 289 327 7.36e1 SMART
Blast:WD40 373 418 2e-8 BLAST
WD40 421 461 1.6e0 SMART
WD40 464 501 2.15e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201545
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains a WD-40 domain, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display partial late embryonic lethality with embryonic growth retardation and abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,088,297 E250G probably damaging Het
Adgra1 A G 7: 139,875,596 N380S probably benign Het
Ap3d1 G A 10: 80,727,167 P160L probably damaging Het
Atg9a C T 1: 75,185,728 V505M probably damaging Het
Chsy3 A T 18: 59,410,030 I747F probably damaging Het
Clec2g A G 6: 128,981,306 S100G probably benign Het
Cmya5 G T 13: 93,092,296 P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 W445R possibly damaging Het
Espl1 T A 15: 102,298,577 L159M probably benign Het
Fam126a A C 5: 23,965,222 S376R possibly damaging Het
Fras1 C T 5: 96,768,363 R3419W probably damaging Het
Galc T A 12: 98,231,413 probably null Het
Ghdc T C 11: 100,769,717 E110G probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
H2-T24 T C 17: 36,014,670 T309A probably benign Het
Helb A C 10: 120,101,486 F618V probably damaging Het
Ifi211 A G 1: 173,907,696 F56L probably damaging Het
Kntc1 T C 5: 123,812,097 F1988L probably damaging Het
Mapk13 G A 17: 28,778,491 S361N probably benign Het
Mapk3 A G 7: 126,764,236 I146V probably benign Het
Megf6 G A 4: 154,253,838 probably null Het
Mug1 G T 6: 121,861,133 V441F probably benign Het
Mymk A G 2: 27,062,214 S173P probably benign Het
Nox4 A G 7: 87,374,408 T501A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 C A 4: 43,854,624 S105Y possibly damaging Het
Olfr666 T C 7: 104,892,897 T244A possibly damaging Het
Prkcb C A 7: 122,289,455 H37Q probably damaging Het
Rabggtb A G 3: 153,909,387 F189L probably damaging Het
Setd1b T C 5: 123,143,408 I75T unknown Het
Slc10a5 T A 3: 10,335,088 R171* probably null Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Slc1a5 T A 7: 16,793,834 W352R probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
St8sia4 A G 1: 95,627,735 M190T probably damaging Het
Tmeff2 A G 1: 50,979,317 M153V probably benign Het
Trappc12 T C 12: 28,746,697 T279A probably damaging Het
Ubn1 G T 16: 5,077,954 A955S probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Vrk1 T A 12: 106,073,606 probably null Het
Zdhhc25 T A 15: 88,601,162 Y233* probably null Het
Zfp109 A G 7: 24,228,754 V418A probably benign Het
Other mutations in Fbxw8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Fbxw8 APN 5 118068097 missense probably benign 0.00
IGL00435:Fbxw8 APN 5 118068137 missense probably benign 0.01
IGL00674:Fbxw8 APN 5 118095593 missense possibly damaging 0.94
IGL01306:Fbxw8 APN 5 118113720 missense possibly damaging 0.88
IGL02389:Fbxw8 APN 5 118128955 missense possibly damaging 0.57
IGL02438:Fbxw8 APN 5 118095693 missense probably benign 0.09
IGL02553:Fbxw8 APN 5 118066060 unclassified probably benign
IGL02752:Fbxw8 APN 5 118142750 missense probably damaging 1.00
IGL02975:Fbxw8 APN 5 118077695 missense probably benign 0.02
IGL03177:Fbxw8 APN 5 118128980 splice site probably benign
IGL03333:Fbxw8 APN 5 118095595 missense possibly damaging 0.94
IGL03407:Fbxw8 APN 5 118142676 missense probably damaging 1.00
ANU23:Fbxw8 UTSW 5 118113720 missense possibly damaging 0.88
R0135:Fbxw8 UTSW 5 118070487 missense probably damaging 1.00
R0760:Fbxw8 UTSW 5 118065901 unclassified probably null
R1115:Fbxw8 UTSW 5 118077571 splice site probably benign
R1498:Fbxw8 UTSW 5 118065785 unclassified probably benign
R1689:Fbxw8 UTSW 5 118077617 missense probably damaging 0.97
R1897:Fbxw8 UTSW 5 118128876 missense probably benign 0.16
R2160:Fbxw8 UTSW 5 118124988 missense probably damaging 1.00
R2345:Fbxw8 UTSW 5 118065807 unclassified probably benign
R3743:Fbxw8 UTSW 5 118113639 missense probably damaging 1.00
R3935:Fbxw8 UTSW 5 118095718 missense probably benign 0.38
R4910:Fbxw8 UTSW 5 118125027 splice site probably null
R5628:Fbxw8 UTSW 5 118092557 missense probably damaging 1.00
R6161:Fbxw8 UTSW 5 118092675 missense possibly damaging 0.94
R6184:Fbxw8 UTSW 5 118113749 missense probably damaging 1.00
R6582:Fbxw8 UTSW 5 118124963 missense probably benign 0.28
R6617:Fbxw8 UTSW 5 118142666 critical splice donor site probably null
R6785:Fbxw8 UTSW 5 118092689 missense probably damaging 1.00
R7363:Fbxw8 UTSW 5 118124992 missense probably damaging 0.97
R7395:Fbxw8 UTSW 5 118068215 missense probably damaging 1.00
R7674:Fbxw8 UTSW 5 118124971 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGTCCTCTGAATGCAAAC -3'
(R):5'- CTGCTGATGTCAGACAGAATGC -3'

Sequencing Primer
(F):5'- AGTAAGCGCTCACCAGCTTCTG -3'
(R):5'- CTGATGTCAGACAGAATGCTGACTAG -3'
Posted On2016-07-22