Incidental Mutation 'R5220:Setd1b'
ID402264
Institutional Source Beutler Lab
Gene Symbol Setd1b
Ensembl Gene ENSMUSG00000038384
Gene NameSET domain containing 1B
SynonymsKMT2G
MMRRC Submission 042793-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5220 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123142193-123168629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123143408 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 75 (I75T)
Ref Sequence ENSEMBL: ENSMUSP00000134461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056053] [ENSMUST00000163030] [ENSMUST00000174836]
Predicted Effect unknown
Transcript: ENSMUST00000056053
AA Change: I75T
SMART Domains Protein: ENSMUSP00000134686
Gene: ENSMUSG00000038384
AA Change: I75T

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162697
Predicted Effect unknown
Transcript: ENSMUST00000163030
AA Change: I75T
SMART Domains Protein: ENSMUSP00000133933
Gene: ENSMUSG00000038384
AA Change: I75T

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174836
AA Change: I75T
SMART Domains Protein: ENSMUSP00000134461
Gene: ENSMUSG00000038384
AA Change: I75T

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.92e-7 PROSPERO
internal_repeat_1 279 296 1.92e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
coiled coil region 1149 1172 N/A INTRINSIC
low complexity region 1208 1221 N/A INTRINSIC
low complexity region 1240 1251 N/A INTRINSIC
low complexity region 1281 1342 N/A INTRINSIC
low complexity region 1361 1401 N/A INTRINSIC
low complexity region 1443 1507 N/A INTRINSIC
low complexity region 1559 1577 N/A INTRINSIC
N-SET 1651 1795 1.54e-67 SMART
SET 1805 1928 4.03e-36 SMART
PostSET 1928 1944 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195992
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant animals died during organogenesis by E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,088,297 E250G probably damaging Het
Adgra1 A G 7: 139,875,596 N380S probably benign Het
Ap3d1 G A 10: 80,727,167 P160L probably damaging Het
Atg9a C T 1: 75,185,728 V505M probably damaging Het
Chsy3 A T 18: 59,410,030 I747F probably damaging Het
Clec2g A G 6: 128,981,306 S100G probably benign Het
Cmya5 G T 13: 93,092,296 P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 W445R possibly damaging Het
Espl1 T A 15: 102,298,577 L159M probably benign Het
Fam126a A C 5: 23,965,222 S376R possibly damaging Het
Fbxw8 T C 5: 118,095,711 D285G possibly damaging Het
Fras1 C T 5: 96,768,363 R3419W probably damaging Het
Galc T A 12: 98,231,413 probably null Het
Ghdc T C 11: 100,769,717 E110G probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
H2-T24 T C 17: 36,014,670 T309A probably benign Het
Helb A C 10: 120,101,486 F618V probably damaging Het
Ifi211 A G 1: 173,907,696 F56L probably damaging Het
Kntc1 T C 5: 123,812,097 F1988L probably damaging Het
Mapk13 G A 17: 28,778,491 S361N probably benign Het
Mapk3 A G 7: 126,764,236 I146V probably benign Het
Megf6 G A 4: 154,253,838 probably null Het
Mug1 G T 6: 121,861,133 V441F probably benign Het
Mymk A G 2: 27,062,214 S173P probably benign Het
Nox4 A G 7: 87,374,408 T501A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 C A 4: 43,854,624 S105Y possibly damaging Het
Olfr666 T C 7: 104,892,897 T244A possibly damaging Het
Prkcb C A 7: 122,289,455 H37Q probably damaging Het
Rabggtb A G 3: 153,909,387 F189L probably damaging Het
Slc10a5 T A 3: 10,335,088 R171* probably null Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Slc1a5 T A 7: 16,793,834 W352R probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
St8sia4 A G 1: 95,627,735 M190T probably damaging Het
Tmeff2 A G 1: 50,979,317 M153V probably benign Het
Trappc12 T C 12: 28,746,697 T279A probably damaging Het
Ubn1 G T 16: 5,077,954 A955S probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Vrk1 T A 12: 106,073,606 probably null Het
Zdhhc25 T A 15: 88,601,162 Y233* probably null Het
Zfp109 A G 7: 24,228,754 V418A probably benign Het
Other mutations in Setd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Setd1b APN 5 123158747 unclassified probably benign
IGL01453:Setd1b APN 5 123158464 intron probably benign
IGL01637:Setd1b APN 5 123148513 missense unknown
IGL01792:Setd1b APN 5 123157146 missense unknown
IGL01877:Setd1b APN 5 123148448 missense unknown
IGL01906:Setd1b APN 5 123157667 missense unknown
IGL01942:Setd1b APN 5 123163426 missense possibly damaging 0.73
IGL02284:Setd1b APN 5 123163428 missense possibly damaging 0.52
IGL02667:Setd1b APN 5 123157497 missense unknown
IGL02850:Setd1b APN 5 123148589 missense unknown
IGL02864:Setd1b APN 5 123158939 unclassified probably benign
IGL03006:Setd1b APN 5 123148451 missense unknown
IGL03307:Setd1b APN 5 123148671 missense unknown
P0037:Setd1b UTSW 5 123165921 unclassified probably benign
R0282:Setd1b UTSW 5 123161017 unclassified probably benign
R0375:Setd1b UTSW 5 123157437 missense unknown
R0550:Setd1b UTSW 5 123157660 missense unknown
R0607:Setd1b UTSW 5 123159951 unclassified probably benign
R0844:Setd1b UTSW 5 123160685 unclassified probably benign
R0973:Setd1b UTSW 5 123160703 small insertion probably benign
R1119:Setd1b UTSW 5 123147716 missense unknown
R1266:Setd1b UTSW 5 123147841 missense unknown
R1370:Setd1b UTSW 5 123160685 unclassified probably benign
R1416:Setd1b UTSW 5 123160685 unclassified probably benign
R1575:Setd1b UTSW 5 123163147 splice site probably benign
R1862:Setd1b UTSW 5 123147613 missense unknown
R1987:Setd1b UTSW 5 123147706 missense unknown
R4109:Setd1b UTSW 5 123152074 small deletion probably benign
R4399:Setd1b UTSW 5 123161798 unclassified probably benign
R4445:Setd1b UTSW 5 123148104 missense unknown
R4577:Setd1b UTSW 5 123148616 missense unknown
R4604:Setd1b UTSW 5 123152074 small deletion probably benign
R4647:Setd1b UTSW 5 123148112 missense unknown
R4648:Setd1b UTSW 5 123148112 missense unknown
R4675:Setd1b UTSW 5 123160998 unclassified probably benign
R5044:Setd1b UTSW 5 123151866 missense unknown
R5071:Setd1b UTSW 5 123160914 unclassified probably benign
R5933:Setd1b UTSW 5 123158752 unclassified probably benign
R6247:Setd1b UTSW 5 123158398 intron probably benign
R6446:Setd1b UTSW 5 123161799 unclassified probably benign
R6714:Setd1b UTSW 5 123157591 missense unknown
R6907:Setd1b UTSW 5 123163232 unclassified probably benign
R7328:Setd1b UTSW 5 123152379 missense unknown
R7412:Setd1b UTSW 5 123152576 missense unknown
R7486:Setd1b UTSW 5 123163592 missense probably benign 0.03
R7542:Setd1b UTSW 5 123148447 missense unknown
R7555:Setd1b UTSW 5 123157757 missense unknown
R7611:Setd1b UTSW 5 123152594 missense unknown
R7764:Setd1b UTSW 5 123146559 missense unknown
R7770:Setd1b UTSW 5 123158752 unclassified probably benign
R7881:Setd1b UTSW 5 123152273 missense unknown
R7964:Setd1b UTSW 5 123152273 missense unknown
Z1177:Setd1b UTSW 5 123158625 missense unknown
Predicted Primers PCR Primer
(F):5'- CATAAACTGTACCGCTACGATGGG -3'
(R):5'- GCCAAAACTTCCCAGTCCTG -3'

Sequencing Primer
(F):5'- CTACGATGGGCAGCATTTCAG -3'
(R):5'- CCTGGACGGCGGGAACTAAG -3'
Posted On2016-07-22