Incidental Mutation 'R5220:Mug1'
ID402266
Institutional Source Beutler Lab
Gene Symbol Mug1
Ensembl Gene ENSMUSG00000059908
Gene Namemurinoglobulin 1
Synonyms
MMRRC Submission 042793-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5220 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location121838541-121889057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121861133 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 441 (V441F)
Ref Sequence ENSEMBL: ENSMUSP00000032228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032228]
Predicted Effect probably benign
Transcript: ENSMUST00000032228
AA Change: V441F

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908
AA Change: V441F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 5e-21 PFAM
A2M_N_2 449 599 2.55e-41 SMART
A2M 740 830 5.43e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
Pfam:A2M_comp 1012 1268 5.4e-94 PFAM
A2M_recep 1378 1465 4.14e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148563
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,088,297 E250G probably damaging Het
Adgra1 A G 7: 139,875,596 N380S probably benign Het
Ap3d1 G A 10: 80,727,167 P160L probably damaging Het
Atg9a C T 1: 75,185,728 V505M probably damaging Het
Chsy3 A T 18: 59,410,030 I747F probably damaging Het
Clec2g A G 6: 128,981,306 S100G probably benign Het
Cmya5 G T 13: 93,092,296 P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 W445R possibly damaging Het
Espl1 T A 15: 102,298,577 L159M probably benign Het
Fam126a A C 5: 23,965,222 S376R possibly damaging Het
Fbxw8 T C 5: 118,095,711 D285G possibly damaging Het
Fras1 C T 5: 96,768,363 R3419W probably damaging Het
Galc T A 12: 98,231,413 probably null Het
Ghdc T C 11: 100,769,717 E110G probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
H2-T24 T C 17: 36,014,670 T309A probably benign Het
Helb A C 10: 120,101,486 F618V probably damaging Het
Ifi211 A G 1: 173,907,696 F56L probably damaging Het
Kntc1 T C 5: 123,812,097 F1988L probably damaging Het
Mapk13 G A 17: 28,778,491 S361N probably benign Het
Mapk3 A G 7: 126,764,236 I146V probably benign Het
Megf6 G A 4: 154,253,838 probably null Het
Mymk A G 2: 27,062,214 S173P probably benign Het
Nox4 A G 7: 87,374,408 T501A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 C A 4: 43,854,624 S105Y possibly damaging Het
Olfr666 T C 7: 104,892,897 T244A possibly damaging Het
Prkcb C A 7: 122,289,455 H37Q probably damaging Het
Rabggtb A G 3: 153,909,387 F189L probably damaging Het
Setd1b T C 5: 123,143,408 I75T unknown Het
Slc10a5 T A 3: 10,335,088 R171* probably null Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Slc1a5 T A 7: 16,793,834 W352R probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
St8sia4 A G 1: 95,627,735 M190T probably damaging Het
Tmeff2 A G 1: 50,979,317 M153V probably benign Het
Trappc12 T C 12: 28,746,697 T279A probably damaging Het
Ubn1 G T 16: 5,077,954 A955S probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Vrk1 T A 12: 106,073,606 probably null Het
Zdhhc25 T A 15: 88,601,162 Y233* probably null Het
Zfp109 A G 7: 24,228,754 V418A probably benign Het
Other mutations in Mug1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mug1 APN 6 121865809 missense probably damaging 1.00
IGL00485:Mug1 APN 6 121887416 missense probably benign 0.17
IGL00816:Mug1 APN 6 121882638 missense probably damaging 0.99
IGL01140:Mug1 APN 6 121882734 missense probably benign 0.01
IGL01141:Mug1 APN 6 121870499 missense probably benign 0.08
IGL01384:Mug1 APN 6 121849474 splice site probably benign
IGL01659:Mug1 APN 6 121870660 splice site probably benign
IGL02049:Mug1 APN 6 121871336 missense probably benign
IGL02151:Mug1 APN 6 121884690 critical splice donor site probably null
IGL02315:Mug1 APN 6 121840167 missense probably benign
IGL02629:Mug1 APN 6 121840065 missense possibly damaging 0.62
IGL02642:Mug1 APN 6 121882585 missense probably benign 0.14
IGL02807:Mug1 APN 6 121886572 missense probably damaging 0.96
IGL02932:Mug1 APN 6 121887427 missense probably benign 0.35
IGL03232:Mug1 APN 6 121878535 missense probably benign 0.00
R1462_Mug1_304 UTSW 6 121882629 missense probably benign 0.41
R2341_Mug1_749 UTSW 6 121884629 missense probably benign 0.06
R4261_Mug1_652 UTSW 6 121873734 missense probably benign
R6173_mug1_139 UTSW 6 121863793 missense probably damaging 0.99
IGL03050:Mug1 UTSW 6 121880571 missense possibly damaging 0.90
R0101:Mug1 UTSW 6 121884247 missense possibly damaging 0.59
R0194:Mug1 UTSW 6 121840107 missense probably damaging 0.98
R0196:Mug1 UTSW 6 121838725 critical splice donor site probably null
R0325:Mug1 UTSW 6 121849842 missense probably benign
R0332:Mug1 UTSW 6 121849897 splice site probably null
R0377:Mug1 UTSW 6 121857361 missense probably benign 0.02
R0393:Mug1 UTSW 6 121849850 missense possibly damaging 0.64
R0414:Mug1 UTSW 6 121856554 missense probably benign 0.00
R0457:Mug1 UTSW 6 121861555 missense probably benign 0.06
R0479:Mug1 UTSW 6 121840227 missense probably benign
R0519:Mug1 UTSW 6 121851424 missense possibly damaging 0.83
R0535:Mug1 UTSW 6 121851454 missense probably benign
R0745:Mug1 UTSW 6 121887427 missense probably benign 0.35
R0939:Mug1 UTSW 6 121884349 missense possibly damaging 0.95
R0975:Mug1 UTSW 6 121878539 missense probably damaging 0.99
R1033:Mug1 UTSW 6 121880551 missense probably damaging 0.99
R1086:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R1116:Mug1 UTSW 6 121870645 missense probably benign
R1131:Mug1 UTSW 6 121861185 missense probably benign 0.18
R1249:Mug1 UTSW 6 121849461 missense probably benign 0.07
R1364:Mug1 UTSW 6 121881713 missense probably damaging 1.00
R1418:Mug1 UTSW 6 121838676 missense probably benign 0.00
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1494:Mug1 UTSW 6 121879300 missense probably damaging 1.00
R1639:Mug1 UTSW 6 121880571 missense probably damaging 1.00
R1901:Mug1 UTSW 6 121881821 missense probably benign
R1902:Mug1 UTSW 6 121881821 missense probably benign
R2087:Mug1 UTSW 6 121856291 missense probably benign 0.00
R2168:Mug1 UTSW 6 121870499 missense probably benign 0.08
R2249:Mug1 UTSW 6 121870510 missense probably benign
R2341:Mug1 UTSW 6 121884629 missense probably benign 0.06
R2888:Mug1 UTSW 6 121881843 missense probably benign 0.44
R2892:Mug1 UTSW 6 121840070 missense possibly damaging 0.91
R3703:Mug1 UTSW 6 121888556 splice site probably benign
R3789:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3790:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3950:Mug1 UTSW 6 121878530 missense probably damaging 1.00
R4261:Mug1 UTSW 6 121873734 missense probably benign
R4402:Mug1 UTSW 6 121879352 missense probably damaging 1.00
R4589:Mug1 UTSW 6 121857351 missense probably benign 0.19
R4707:Mug1 UTSW 6 121884641 missense probably damaging 1.00
R4766:Mug1 UTSW 6 121884254 missense probably benign 0.01
R4840:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R4984:Mug1 UTSW 6 121838617 utr 5 prime probably benign
R4999:Mug1 UTSW 6 121878943 nonsense probably null
R5198:Mug1 UTSW 6 121874562 missense probably damaging 1.00
R5253:Mug1 UTSW 6 121888913 missense probably benign 0.03
R5273:Mug1 UTSW 6 121873789 missense probably damaging 0.99
R5285:Mug1 UTSW 6 121841107 missense probably benign 0.45
R5387:Mug1 UTSW 6 121884394 missense probably damaging 0.99
R5560:Mug1 UTSW 6 121861073 missense probably damaging 0.96
R5652:Mug1 UTSW 6 121840181 missense probably benign
R5704:Mug1 UTSW 6 121851433 missense possibly damaging 0.63
R5732:Mug1 UTSW 6 121878493 missense probably benign 0.00
R6053:Mug1 UTSW 6 121865738 missense probably benign 0.00
R6173:Mug1 UTSW 6 121863793 missense probably damaging 0.99
R6578:Mug1 UTSW 6 121887452 missense probably benign 0.00
R6647:Mug1 UTSW 6 121840241 missense probably benign 0.02
R6681:Mug1 UTSW 6 121838724 missense possibly damaging 0.75
R6925:Mug1 UTSW 6 121881787 missense probably damaging 1.00
R7014:Mug1 UTSW 6 121861125 missense probably benign 0.22
R7031:Mug1 UTSW 6 121838714 missense probably benign 0.00
R7034:Mug1 UTSW 6 121873644 missense probably benign 0.00
R7156:Mug1 UTSW 6 121880905 missense probably damaging 1.00
R7156:Mug1 UTSW 6 121884343 missense probably damaging 1.00
R7179:Mug1 UTSW 6 121857420 missense probably benign 0.00
R7211:Mug1 UTSW 6 121880539 missense possibly damaging 0.52
R7318:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7462:Mug1 UTSW 6 121875440 missense probably benign 0.00
R7479:Mug1 UTSW 6 121878508 missense possibly damaging 0.83
R7588:Mug1 UTSW 6 121875517 missense probably damaging 1.00
R7611:Mug1 UTSW 6 121875428 critical splice acceptor site probably null
R7659:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7660:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7661:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7663:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7664:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7666:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7788:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7789:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7794:Mug1 UTSW 6 121856288 missense possibly damaging 0.93
R7809:Mug1 UTSW 6 121878985 missense possibly damaging 0.79
R7836:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7867:Mug1 UTSW 6 121873634 missense probably benign
R7904:Mug1 UTSW 6 121851465 missense probably benign
R7937:Mug1 UTSW 6 121861169 missense probably benign 0.00
R7981:Mug1 UTSW 6 121881764 missense probably damaging 1.00
R7999:Mug1 UTSW 6 121880896 missense possibly damaging 0.90
R8070:Mug1 UTSW 6 121875879 missense probably benign 0.26
R8071:Mug1 UTSW 6 121873672 missense probably benign
R8151:Mug1 UTSW 6 121841158 missense probably benign 0.01
R8491:Mug1 UTSW 6 121882729 missense probably damaging 1.00
R8714:Mug1 UTSW 6 121882722 missense probably benign 0.01
R8734:Mug1 UTSW 6 121871381 missense probably benign 0.00
R8807:Mug1 UTSW 6 121874475 missense probably benign 0.27
R8931:Mug1 UTSW 6 121884337 missense probably benign
R8940:Mug1 UTSW 6 121881683 missense
RF017:Mug1 UTSW 6 121884574 missense probably damaging 1.00
X0064:Mug1 UTSW 6 121861215 missense possibly damaging 0.48
Z1176:Mug1 UTSW 6 121841294 missense probably benign 0.32
Z1176:Mug1 UTSW 6 121880493 missense probably damaging 1.00
Z1177:Mug1 UTSW 6 121863808 missense probably damaging 0.99
Z1177:Mug1 UTSW 6 121879299 critical splice acceptor site probably null
Z1177:Mug1 UTSW 6 121886568 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCAGGGTGTTAGACATCAATCC -3'
(R):5'- TGTTTCAATTTGGAGCCAGTAC -3'

Sequencing Primer
(F):5'- TCAATCCATTTAATGAAATTCCCTCC -3'
(R):5'- ATTTGGAGCCAGTACTCACCAGG -3'
Posted On2016-07-22