Incidental Mutation 'R5220:Slc1a5'
ID402268
Institutional Source Beutler Lab
Gene Symbol Slc1a5
Ensembl Gene ENSMUSG00000001918
Gene Namesolute carrier family 1 (neutral amino acid transporter), member 5
SynonymsASCT2
MMRRC Submission 042793-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R5220 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16781340-16798274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16793834 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 352 (W352R)
Ref Sequence ENSEMBL: ENSMUSP00000104136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108496]
Predicted Effect probably damaging
Transcript: ENSMUST00000108496
AA Change: W352R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104136
Gene: ENSMUSG00000001918
AA Change: W352R

DomainStartEndE-ValueType
Pfam:SDF 55 499 1.5e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135817
SMART Domains Protein: ENSMUSP00000116654
Gene: ENSMUSG00000001918

DomainStartEndE-ValueType
Pfam:SDF 3 139 7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147814
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC1A5 gene encodes a sodium-dependent neutral amino acid transporter that can act as a receptor for RD114/type D retrovirus (Larriba et al., 2001 [PubMed 11781704]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced B cells, CD4+ memory T cells in older mice, Th1 and Th17 T cells, susceptibility to EAE and T cell uptake of glutamine and leucine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,088,297 E250G probably damaging Het
Adgra1 A G 7: 139,875,596 N380S probably benign Het
Ap3d1 G A 10: 80,727,167 P160L probably damaging Het
Atg9a C T 1: 75,185,728 V505M probably damaging Het
Chsy3 A T 18: 59,410,030 I747F probably damaging Het
Clec2g A G 6: 128,981,306 S100G probably benign Het
Cmya5 G T 13: 93,092,296 P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 W445R possibly damaging Het
Espl1 T A 15: 102,298,577 L159M probably benign Het
Fam126a A C 5: 23,965,222 S376R possibly damaging Het
Fbxw8 T C 5: 118,095,711 D285G possibly damaging Het
Fras1 C T 5: 96,768,363 R3419W probably damaging Het
Galc T A 12: 98,231,413 probably null Het
Ghdc T C 11: 100,769,717 E110G probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
H2-T24 T C 17: 36,014,670 T309A probably benign Het
Helb A C 10: 120,101,486 F618V probably damaging Het
Ifi211 A G 1: 173,907,696 F56L probably damaging Het
Kntc1 T C 5: 123,812,097 F1988L probably damaging Het
Mapk13 G A 17: 28,778,491 S361N probably benign Het
Mapk3 A G 7: 126,764,236 I146V probably benign Het
Megf6 G A 4: 154,253,838 probably null Het
Mug1 G T 6: 121,861,133 V441F probably benign Het
Mymk A G 2: 27,062,214 S173P probably benign Het
Nox4 A G 7: 87,374,408 T501A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 C A 4: 43,854,624 S105Y possibly damaging Het
Olfr666 T C 7: 104,892,897 T244A possibly damaging Het
Prkcb C A 7: 122,289,455 H37Q probably damaging Het
Rabggtb A G 3: 153,909,387 F189L probably damaging Het
Setd1b T C 5: 123,143,408 I75T unknown Het
Slc10a5 T A 3: 10,335,088 R171* probably null Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
St8sia4 A G 1: 95,627,735 M190T probably damaging Het
Tmeff2 A G 1: 50,979,317 M153V probably benign Het
Trappc12 T C 12: 28,746,697 T279A probably damaging Het
Ubn1 G T 16: 5,077,954 A955S probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Vrk1 T A 12: 106,073,606 probably null Het
Zdhhc25 T A 15: 88,601,162 Y233* probably null Het
Zfp109 A G 7: 24,228,754 V418A probably benign Het
Other mutations in Slc1a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Slc1a5 APN 7 16786879 nonsense probably null
IGL01295:Slc1a5 APN 7 16795862 missense probably damaging 1.00
IGL02388:Slc1a5 APN 7 16785719 critical splice donor site probably null
IGL02863:Slc1a5 APN 7 16793721 missense probably benign
IGL03149:Slc1a5 APN 7 16789820 missense probably damaging 0.96
R0001:Slc1a5 UTSW 7 16793637 splice site probably null
R0368:Slc1a5 UTSW 7 16782178 missense probably damaging 1.00
R0690:Slc1a5 UTSW 7 16786904 missense probably benign
R1430:Slc1a5 UTSW 7 16782403 missense probably benign 0.00
R1769:Slc1a5 UTSW 7 16797539 missense probably damaging 1.00
R4058:Slc1a5 UTSW 7 16795853 missense probably damaging 0.98
R4944:Slc1a5 UTSW 7 16797743 utr 3 prime probably benign
R5976:Slc1a5 UTSW 7 16795882 missense probably damaging 1.00
R5986:Slc1a5 UTSW 7 16782226 missense probably benign 0.26
R7171:Slc1a5 UTSW 7 16797538 missense probably damaging 1.00
R7270:Slc1a5 UTSW 7 16785698 missense probably damaging 1.00
R7345:Slc1a5 UTSW 7 16796160 critical splice donor site probably null
R7630:Slc1a5 UTSW 7 16795807 missense probably damaging 1.00
R7920:Slc1a5 UTSW 7 16793870 missense probably damaging 1.00
R7944:Slc1a5 UTSW 7 16789882 missense possibly damaging 0.50
R7945:Slc1a5 UTSW 7 16789882 missense possibly damaging 0.50
R8221:Slc1a5 UTSW 7 16781977 missense probably benign 0.05
Z1088:Slc1a5 UTSW 7 16797669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGATGATCAGGTACGCACC -3'
(R):5'- ACATTGCACTGTCACCTCAC -3'

Sequencing Primer
(F):5'- GCACCCGTTGGAATCCTG -3'
(R):5'- CACATGGTGGCTCAGAGCTAAC -3'
Posted On2016-07-22