Incidental Mutation 'R5220:Prkcb'
ID402274
Institutional Source Beutler Lab
Gene Symbol Prkcb
Ensembl Gene ENSMUSG00000052889
Gene Nameprotein kinase C, beta
SynonymsPkcb, Prkcb2, Prkcb1, A130082F03Rik, PKC-Beta
MMRRC Submission 042793-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5220 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location122288751-122634402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122289455 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 37 (H37Q)
Ref Sequence ENSEMBL: ENSMUSP00000138788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064921] [ENSMUST00000064989] [ENSMUST00000143692]
Predicted Effect probably damaging
Transcript: ENSMUST00000064921
AA Change: H37Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064812
Gene: ENSMUSG00000052889
AA Change: H37Q

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 664 9.86e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064989
AA Change: H37Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: H37Q

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131167
Predicted Effect probably damaging
Transcript: ENSMUST00000143692
AA Change: H37Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138788
Gene: ENSMUSG00000052889
AA Change: H37Q

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,088,297 E250G probably damaging Het
Adgra1 A G 7: 139,875,596 N380S probably benign Het
Ap3d1 G A 10: 80,727,167 P160L probably damaging Het
Atg9a C T 1: 75,185,728 V505M probably damaging Het
Chsy3 A T 18: 59,410,030 I747F probably damaging Het
Clec2g A G 6: 128,981,306 S100G probably benign Het
Cmya5 G T 13: 93,092,296 P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 W445R possibly damaging Het
Espl1 T A 15: 102,298,577 L159M probably benign Het
Fam126a A C 5: 23,965,222 S376R possibly damaging Het
Fbxw8 T C 5: 118,095,711 D285G possibly damaging Het
Fras1 C T 5: 96,768,363 R3419W probably damaging Het
Galc T A 12: 98,231,413 probably null Het
Ghdc T C 11: 100,769,717 E110G probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
H2-T24 T C 17: 36,014,670 T309A probably benign Het
Helb A C 10: 120,101,486 F618V probably damaging Het
Ifi211 A G 1: 173,907,696 F56L probably damaging Het
Kntc1 T C 5: 123,812,097 F1988L probably damaging Het
Mapk13 G A 17: 28,778,491 S361N probably benign Het
Mapk3 A G 7: 126,764,236 I146V probably benign Het
Megf6 G A 4: 154,253,838 probably null Het
Mug1 G T 6: 121,861,133 V441F probably benign Het
Mymk A G 2: 27,062,214 S173P probably benign Het
Nox4 A G 7: 87,374,408 T501A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 C A 4: 43,854,624 S105Y possibly damaging Het
Olfr666 T C 7: 104,892,897 T244A possibly damaging Het
Rabggtb A G 3: 153,909,387 F189L probably damaging Het
Setd1b T C 5: 123,143,408 I75T unknown Het
Slc10a5 T A 3: 10,335,088 R171* probably null Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Slc1a5 T A 7: 16,793,834 W352R probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
St8sia4 A G 1: 95,627,735 M190T probably damaging Het
Tmeff2 A G 1: 50,979,317 M153V probably benign Het
Trappc12 T C 12: 28,746,697 T279A probably damaging Het
Ubn1 G T 16: 5,077,954 A955S probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Vrk1 T A 12: 106,073,606 probably null Het
Zdhhc25 T A 15: 88,601,162 Y233* probably null Het
Zfp109 A G 7: 24,228,754 V418A probably benign Het
Other mutations in Prkcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
tilcara APN 7 122595005 missense probably damaging 1.00
IGL02045:Prkcb APN 7 122590167 missense probably damaging 1.00
IGL02273:Prkcb APN 7 122627767 missense probably damaging 1.00
IGL02638:Prkcb APN 7 122600840 splice site probably benign
IGL02962:Prkcb APN 7 122425047 splice site probably null
IGL03013:Prkcb APN 7 122627682 missense probably damaging 1.00
IGL03224:Prkcb APN 7 122516924 nonsense probably null
Almonde UTSW 7 122582449 missense probably damaging 1.00
Baghdad UTSW 7 122627663 missense probably benign 0.07
Mesopotamia UTSW 7 122289514 missense probably damaging 1.00
Mosul UTSW 7 122516844 missense probably damaging 1.00
tigris UTSW 7 122424977 missense probably damaging 1.00
Tikrit UTSW 7 122627693 missense probably damaging 1.00
untied UTSW 7 122582439 missense possibly damaging 0.90
F5770:Prkcb UTSW 7 122528476 missense probably damaging 0.99
R0078:Prkcb UTSW 7 122590170 missense probably damaging 1.00
R0409:Prkcb UTSW 7 122424977 missense probably damaging 1.00
R0660:Prkcb UTSW 7 122424959 missense possibly damaging 0.56
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1480:Prkcb UTSW 7 122594642 missense probably damaging 1.00
R1518:Prkcb UTSW 7 122544631 critical splice acceptor site probably null
R1540:Prkcb UTSW 7 122627693 missense probably damaging 1.00
R1860:Prkcb UTSW 7 122568201 missense probably damaging 1.00
R3110:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R3112:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R4583:Prkcb UTSW 7 122457224 missense probably benign 0.32
R4847:Prkcb UTSW 7 122568149 missense probably benign 0.35
R5487:Prkcb UTSW 7 122600725 nonsense probably null
R5599:Prkcb UTSW 7 122582478 missense probably benign 0.17
R5946:Prkcb UTSW 7 122544703 missense probably benign
R6257:Prkcb UTSW 7 122568163 missense probably benign
R6590:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6618:Prkcb UTSW 7 122627663 missense probably benign 0.07
R6690:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6763:Prkcb UTSW 7 122594664 missense probably damaging 1.00
R7289:Prkcb UTSW 7 122544687 missense probably benign 0.04
R7414:Prkcb UTSW 7 122568227 missense possibly damaging 0.83
R7466:Prkcb UTSW 7 122516844 missense probably damaging 1.00
R7540:Prkcb UTSW 7 122568134 missense probably damaging 0.99
V7581:Prkcb UTSW 7 122528476 missense probably damaging 0.99
X0061:Prkcb UTSW 7 122457306 missense probably benign 0.03
Z1177:Prkcb UTSW 7 122568196 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTGGGTTTCATGCAAATGAGGG -3'
(R):5'- CTGAGCCAGGTGTCGAAAAG -3'

Sequencing Primer
(F):5'- TGCCAAGCACAGCTGGAC -3'
(R):5'- TGTCGAAAAGGCGCCTG -3'
Posted On2016-07-22