Incidental Mutation 'R5220:Slc12a4'
ID402276
Institutional Source Beutler Lab
Gene Symbol Slc12a4
Ensembl Gene ENSMUSG00000017765
Gene Namesolute carrier family 12, member 4
SynonymsKCC1, K-Cl Co-transporter-1
MMRRC Submission 042793-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R5220 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105943590-105966097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105953852 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 211 (F211L)
Ref Sequence ENSEMBL: ENSMUSP00000112130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034370] [ENSMUST00000116429]
Predicted Effect probably damaging
Transcript: ENSMUST00000034370
AA Change: F213L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765
AA Change: F213L

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Pfam:AA_permease 125 318 5.8e-28 PFAM
Pfam:AA_permease 409 698 1.2e-40 PFAM
Pfam:SLC12 710 833 7.1e-18 PFAM
Pfam:SLC12 829 1087 4.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116429
AA Change: F211L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765
AA Change: F211L

DomainStartEndE-ValueType
low complexity region 95 115 N/A INTRINSIC
Pfam:AA_permease 123 309 7.7e-29 PFAM
Pfam:AA_permease_2 390 654 2.9e-17 PFAM
Pfam:AA_permease 404 696 4.4e-39 PFAM
Pfam:KCl_Cotrans_1 953 982 9.2e-21 PFAM
low complexity region 1065 1080 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132231
SMART Domains Protein: ENSMUSP00000121018
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 66 86 N/A INTRINSIC
Pfam:AA_permease 94 171 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183884
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC12A transporter family. The encoded protein mediates the coupled movement of potassium and chloride ions across the plasma membrane. This gene is expressed ubiquitously. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a constitutively active mutation display microcytosis and hypochromic anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,088,297 E250G probably damaging Het
Adgra1 A G 7: 139,875,596 N380S probably benign Het
Ap3d1 G A 10: 80,727,167 P160L probably damaging Het
Atg9a C T 1: 75,185,728 V505M probably damaging Het
Chsy3 A T 18: 59,410,030 I747F probably damaging Het
Clec2g A G 6: 128,981,306 S100G probably benign Het
Cmya5 G T 13: 93,092,296 P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 W445R possibly damaging Het
Espl1 T A 15: 102,298,577 L159M probably benign Het
Fam126a A C 5: 23,965,222 S376R possibly damaging Het
Fbxw8 T C 5: 118,095,711 D285G possibly damaging Het
Fras1 C T 5: 96,768,363 R3419W probably damaging Het
Galc T A 12: 98,231,413 probably null Het
Ghdc T C 11: 100,769,717 E110G probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
H2-T24 T C 17: 36,014,670 T309A probably benign Het
Helb A C 10: 120,101,486 F618V probably damaging Het
Ifi211 A G 1: 173,907,696 F56L probably damaging Het
Kntc1 T C 5: 123,812,097 F1988L probably damaging Het
Mapk13 G A 17: 28,778,491 S361N probably benign Het
Mapk3 A G 7: 126,764,236 I146V probably benign Het
Megf6 G A 4: 154,253,838 probably null Het
Mug1 G T 6: 121,861,133 V441F probably benign Het
Mymk A G 2: 27,062,214 S173P probably benign Het
Nox4 A G 7: 87,374,408 T501A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 C A 4: 43,854,624 S105Y possibly damaging Het
Olfr666 T C 7: 104,892,897 T244A possibly damaging Het
Prkcb C A 7: 122,289,455 H37Q probably damaging Het
Rabggtb A G 3: 153,909,387 F189L probably damaging Het
Setd1b T C 5: 123,143,408 I75T unknown Het
Slc10a5 T A 3: 10,335,088 R171* probably null Het
Slc1a5 T A 7: 16,793,834 W352R probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
St8sia4 A G 1: 95,627,735 M190T probably damaging Het
Tmeff2 A G 1: 50,979,317 M153V probably benign Het
Trappc12 T C 12: 28,746,697 T279A probably damaging Het
Ubn1 G T 16: 5,077,954 A955S probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Vrk1 T A 12: 106,073,606 probably null Het
Zdhhc25 T A 15: 88,601,162 Y233* probably null Het
Zfp109 A G 7: 24,228,754 V418A probably benign Het
Other mutations in Slc12a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Slc12a4 APN 8 105944089 missense probably damaging 1.00
IGL01637:Slc12a4 APN 8 105960707 missense possibly damaging 0.72
IGL01736:Slc12a4 APN 8 105945843 critical splice donor site probably null
IGL01804:Slc12a4 APN 8 105944401 missense probably damaging 1.00
IGL02000:Slc12a4 APN 8 105945232 missense probably damaging 1.00
IGL02526:Slc12a4 APN 8 105949806 missense possibly damaging 0.90
IGL03371:Slc12a4 APN 8 105950505 missense probably null 0.99
IGL03385:Slc12a4 APN 8 105950864 unclassified probably benign
ablution UTSW 8 105945223 missense probably damaging 1.00
custom UTSW 8 105950836 missense probably benign 0.00
PIT4810001:Slc12a4 UTSW 8 105951596 missense probably benign 0.00
R0033:Slc12a4 UTSW 8 105947479 splice site probably benign
R0200:Slc12a4 UTSW 8 105951617 missense probably benign 0.09
R0201:Slc12a4 UTSW 8 105945350 missense possibly damaging 0.79
R0270:Slc12a4 UTSW 8 105945389 missense probably benign 0.10
R0389:Slc12a4 UTSW 8 105951967 missense probably benign 0.00
R0432:Slc12a4 UTSW 8 105959488 missense probably damaging 1.00
R0751:Slc12a4 UTSW 8 105951900 missense probably damaging 1.00
R1717:Slc12a4 UTSW 8 105947571 splice site probably null
R1792:Slc12a4 UTSW 8 105951843 missense possibly damaging 0.91
R1940:Slc12a4 UTSW 8 105946037 missense probably benign 0.29
R3115:Slc12a4 UTSW 8 105959459 missense probably damaging 1.00
R4898:Slc12a4 UTSW 8 105944609 missense probably damaging 1.00
R5182:Slc12a4 UTSW 8 105944606 missense probably damaging 1.00
R5283:Slc12a4 UTSW 8 105950694 critical splice donor site probably null
R5367:Slc12a4 UTSW 8 105951634 missense probably damaging 0.99
R5610:Slc12a4 UTSW 8 105950213 missense possibly damaging 0.87
R5921:Slc12a4 UTSW 8 105945244 critical splice acceptor site probably null
R6060:Slc12a4 UTSW 8 105945706 missense probably damaging 1.00
R6182:Slc12a4 UTSW 8 105947899 missense probably damaging 1.00
R6722:Slc12a4 UTSW 8 105944250 splice site probably null
R6800:Slc12a4 UTSW 8 105949739 missense probably damaging 1.00
R6956:Slc12a4 UTSW 8 105953852 missense probably damaging 1.00
R7032:Slc12a4 UTSW 8 105949233 missense probably damaging 1.00
R7092:Slc12a4 UTSW 8 105945223 missense probably damaging 1.00
R7229:Slc12a4 UTSW 8 105946737 missense probably benign 0.05
R7243:Slc12a4 UTSW 8 105953920 missense probably damaging 1.00
R7323:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7325:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7327:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7426:Slc12a4 UTSW 8 105950836 missense probably benign 0.00
R7569:Slc12a4 UTSW 8 105945847 missense probably damaging 1.00
R7710:Slc12a4 UTSW 8 105945571 missense possibly damaging 0.95
R7968:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7970:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7971:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7972:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7973:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R8221:Slc12a4 UTSW 8 105951969 missense probably benign 0.00
R8386:Slc12a4 UTSW 8 105951618 missense probably damaging 1.00
R8393:Slc12a4 UTSW 8 105951819 missense probably damaging 0.99
R8751:Slc12a4 UTSW 8 105949653 critical splice donor site probably null
R8786:Slc12a4 UTSW 8 105953917 missense probably damaging 1.00
R8792:Slc12a4 UTSW 8 105946758 missense probably damaging 1.00
X0019:Slc12a4 UTSW 8 105944352 missense probably damaging 0.98
Z1177:Slc12a4 UTSW 8 105946732 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CTGAGCAATGGGTTTTCTCTCTAAAG -3'
(R):5'- TCAGGACAGATTCTGCGCTG -3'

Sequencing Primer
(F):5'- AATGGGTTTTCTCTCTAAAGGCCTC -3'
(R):5'- CAGATTCTGCGCTGGTCTATTAAAG -3'
Posted On2016-07-22