Mutagenetix > Incidental Mutations

Incidental Mutation 'R5220:Olfr1'

402279

Institutional Source

Beutler Lab

Gene Symbol

Olfr1

Ensembl Gene

ENSMUSG00000069823

Gene Name

olfactory receptor 1

Synonyms

I54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390

MMRRC Submission

042793-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R5220 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

73393010-73399614 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

AGCGGTCGTAGGC to AGC at 73395654 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]

Predicted Effect

probably null
Transcript: ENSMUST00000120303

SMART Domains

Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	8.7e-60	PFAM
Pfam:7tm_1	41	290	2e-27	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000131253

SMART Domains

Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	31	184	1.2e-6	PFAM
Pfam:7TM_GPCR_Srsx	35	171	6.1e-8	PFAM
Pfam:7tm_1	41	191	3.6e-30	PFAM
Pfam:7tm_4	139	196	1.4e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134011

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 79,088,297	E250G	probably damaging	Het
Adgra1	A	G	7: 139,875,596	N380S	probably benign	Het
Ap3d1	G	A	10: 80,727,167	P160L	probably damaging	Het
Atg9a	C	T	1: 75,185,728	V505M	probably damaging	Het
Chsy3	A	T	18: 59,410,030	I747F	probably damaging	Het
Clec2g	A	G	6: 128,981,306	S100G	probably benign	Het
Cmya5	G	T	13: 93,092,296	P2095T	probably damaging	Het
Dcaf10	T	C	4: 45,373,909	W445R	possibly damaging	Het
Espl1	T	A	15: 102,298,577	L159M	probably benign	Het
Fam126a	A	C	5: 23,965,222	S376R	possibly damaging	Het
Fbxw8	T	C	5: 118,095,711	D285G	possibly damaging	Het
Fras1	C	T	5: 96,768,363	R3419W	probably damaging	Het
Galc	T	A	12: 98,231,413		probably null	Het
Ghdc	T	C	11: 100,769,717	E110G	probably damaging	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
H2-T24	T	C	17: 36,014,670	T309A	probably benign	Het
Helb	A	C	10: 120,101,486	F618V	probably damaging	Het
Ifi211	A	G	1: 173,907,696	F56L	probably damaging	Het
Kntc1	T	C	5: 123,812,097	F1988L	probably damaging	Het
Mapk13	G	A	17: 28,778,491	S361N	probably benign	Het
Mapk3	A	G	7: 126,764,236	I146V	probably benign	Het
Megf6	G	A	4: 154,253,838		probably null	Het
Mug1	G	T	6: 121,861,133	V441F	probably benign	Het
Mymk	A	G	2: 27,062,214	S173P	probably benign	Het
Nox4	A	G	7: 87,374,408	T501A	possibly damaging	Het
Olfr155	C	A	4: 43,854,624	S105Y	possibly damaging	Het
Olfr666	T	C	7: 104,892,897	T244A	possibly damaging	Het
Prkcb	C	A	7: 122,289,455	H37Q	probably damaging	Het
Rabggtb	A	G	3: 153,909,387	F189L	probably damaging	Het
Setd1b	T	C	5: 123,143,408	I75T	unknown	Het
Slc10a5	T	A	3: 10,335,088	R171*	probably null	Het
Slc12a4	A	G	8: 105,953,852	F211L	probably damaging	Het
Slc1a5	T	A	7: 16,793,834	W352R	probably damaging	Het
Slc22a27	C	G	19: 7,865,938	A359P	probably damaging	Het
St8sia4	A	G	1: 95,627,735	M190T	probably damaging	Het
Tmeff2	A	G	1: 50,979,317	M153V	probably benign	Het
Trappc12	T	C	12: 28,746,697	T279A	probably damaging	Het
Ubn1	G	T	16: 5,077,954	A955S	probably benign	Het
Usp24	T	A	4: 106,382,303	H1147Q	possibly damaging	Het
Vrk1	T	A	12: 106,073,606		probably null	Het
Zdhhc25	T	A	15: 88,601,162	Y233*	probably null	Het
Zfp109	A	G	7: 24,228,754	V418A	probably benign	Het

Other mutations in Olfr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Olfr1	APN	11	73395191	missense	probably damaging	0.98
IGL01938:Olfr1	APN	11	73395645	missense	probably damaging	1.00
IGL02270:Olfr1	APN	11	73395365	missense	probably benign
IGL03287:Olfr1	APN	11	73396019	start codon destroyed	probably null	1.00
R0006:Olfr1	UTSW	11	73395488	missense	probably damaging	0.99
R0907:Olfr1	UTSW	11	73395119	missense	probably damaging	0.97
R1982:Olfr1	UTSW	11	73395092	missense	probably benign	0.00
R3804:Olfr1	UTSW	11	73395950	missense	probably benign	0.01
R4064:Olfr1	UTSW	11	73395522	missense	probably benign	0.04
R4171:Olfr1	UTSW	11	73395539	missense	probably damaging	1.00
R4724:Olfr1	UTSW	11	73395155	missense	probably damaging	1.00
R4732:Olfr1	UTSW	11	73395695	missense	probably benign	0.03
R4733:Olfr1	UTSW	11	73395695	missense	probably benign	0.03
R5030:Olfr1	UTSW	11	73395654	frame shift	probably null
R5097:Olfr1	UTSW	11	73395293	missense	probably damaging	1.00
R5098:Olfr1	UTSW	11	73395654	frame shift	probably null
R5101:Olfr1	UTSW	11	73395654	frame shift	probably null
R5135:Olfr1	UTSW	11	73395654	frame shift	probably null
R5137:Olfr1	UTSW	11	73395654	frame shift	probably null
R5192:Olfr1	UTSW	11	73395654	frame shift	probably null
R5193:Olfr1	UTSW	11	73395653	frame shift	probably null
R5193:Olfr1	UTSW	11	73395654	frame shift	probably null
R5197:Olfr1	UTSW	11	73395654	frame shift	probably null
R5221:Olfr1	UTSW	11	73395654	frame shift	probably null
R5222:Olfr1	UTSW	11	73395654	frame shift	probably null
R5258:Olfr1	UTSW	11	73395654	frame shift	probably null
R5297:Olfr1	UTSW	11	73395654	frame shift	probably null
R5396:Olfr1	UTSW	11	73395654	frame shift	probably null
R5398:Olfr1	UTSW	11	73395654	frame shift	probably null
R5399:Olfr1	UTSW	11	73395654	frame shift	probably null
R5432:Olfr1	UTSW	11	73395654	frame shift	probably null
R5433:Olfr1	UTSW	11	73395654	frame shift	probably null
R5531:Olfr1	UTSW	11	73395177	missense	probably benign	0.26
R5634:Olfr1	UTSW	11	73395654	frame shift	probably null
R5714:Olfr1	UTSW	11	73395361	splice site	probably null
R5812:Olfr1	UTSW	11	73395654	frame shift	probably null
R5813:Olfr1	UTSW	11	73395654	frame shift	probably null
R5814:Olfr1	UTSW	11	73395654	frame shift	probably null
R5815:Olfr1	UTSW	11	73395654	frame shift	probably null
R5913:Olfr1	UTSW	11	73395654	frame shift	probably null
R5955:Olfr1	UTSW	11	73395654	frame shift	probably null
R5956:Olfr1	UTSW	11	73395654	frame shift	probably null
R5968:Olfr1	UTSW	11	73395192	missense	possibly damaging	0.75
R6029:Olfr1	UTSW	11	73395654	frame shift	probably null
R6034:Olfr1	UTSW	11	73395654	frame shift	probably null
R6034:Olfr1	UTSW	11	73395654	frame shift	probably null
R6176:Olfr1	UTSW	11	73395654	frame shift	probably null
R6177:Olfr1	UTSW	11	73395654	frame shift	probably null
R6178:Olfr1	UTSW	11	73395654	frame shift	probably null
R6196:Olfr1	UTSW	11	73395473	missense	probably benign	0.08
R6995:Olfr1	UTSW	11	73395584	missense	probably benign
R7035:Olfr1	UTSW	11	73395718	missense	probably benign	0.00
R7470:Olfr1	UTSW	11	73395888	missense	probably damaging	1.00
R7530:Olfr1	UTSW	11	73388363	missense	possibly damaging	0.55
R8461:Olfr1	UTSW	11	73395156	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTAACACGGGTGTCAGAGC -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'

Posted On

2016-07-22