Incidental Mutation 'R5220:Olfr1'
ID402279
Institutional Source Beutler Lab
Gene Symbol Olfr1
Ensembl Gene ENSMUSG00000069823
Gene Nameolfactory receptor 1
SynonymsI54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390
MMRRC Submission 042793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5220 (G1)
Quality Score217
Status Not validated
Chromosome11
Chromosomal Location73393010-73399614 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGCGGTCGTAGGC to AGC at 73395654 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
Predicted Effect probably null
Transcript: ENSMUST00000120303
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,088,297 E250G probably damaging Het
Adgra1 A G 7: 139,875,596 N380S probably benign Het
Ap3d1 G A 10: 80,727,167 P160L probably damaging Het
Atg9a C T 1: 75,185,728 V505M probably damaging Het
Chsy3 A T 18: 59,410,030 I747F probably damaging Het
Clec2g A G 6: 128,981,306 S100G probably benign Het
Cmya5 G T 13: 93,092,296 P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 W445R possibly damaging Het
Espl1 T A 15: 102,298,577 L159M probably benign Het
Fam126a A C 5: 23,965,222 S376R possibly damaging Het
Fbxw8 T C 5: 118,095,711 D285G possibly damaging Het
Fras1 C T 5: 96,768,363 R3419W probably damaging Het
Galc T A 12: 98,231,413 probably null Het
Ghdc T C 11: 100,769,717 E110G probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
H2-T24 T C 17: 36,014,670 T309A probably benign Het
Helb A C 10: 120,101,486 F618V probably damaging Het
Ifi211 A G 1: 173,907,696 F56L probably damaging Het
Kntc1 T C 5: 123,812,097 F1988L probably damaging Het
Mapk13 G A 17: 28,778,491 S361N probably benign Het
Mapk3 A G 7: 126,764,236 I146V probably benign Het
Megf6 G A 4: 154,253,838 probably null Het
Mug1 G T 6: 121,861,133 V441F probably benign Het
Mymk A G 2: 27,062,214 S173P probably benign Het
Nox4 A G 7: 87,374,408 T501A possibly damaging Het
Olfr155 C A 4: 43,854,624 S105Y possibly damaging Het
Olfr666 T C 7: 104,892,897 T244A possibly damaging Het
Prkcb C A 7: 122,289,455 H37Q probably damaging Het
Rabggtb A G 3: 153,909,387 F189L probably damaging Het
Setd1b T C 5: 123,143,408 I75T unknown Het
Slc10a5 T A 3: 10,335,088 R171* probably null Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Slc1a5 T A 7: 16,793,834 W352R probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
St8sia4 A G 1: 95,627,735 M190T probably damaging Het
Tmeff2 A G 1: 50,979,317 M153V probably benign Het
Trappc12 T C 12: 28,746,697 T279A probably damaging Het
Ubn1 G T 16: 5,077,954 A955S probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Vrk1 T A 12: 106,073,606 probably null Het
Zdhhc25 T A 15: 88,601,162 Y233* probably null Het
Zfp109 A G 7: 24,228,754 V418A probably benign Het
Other mutations in Olfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Olfr1 APN 11 73395191 missense probably damaging 0.98
IGL01938:Olfr1 APN 11 73395645 missense probably damaging 1.00
IGL02270:Olfr1 APN 11 73395365 missense probably benign
IGL03287:Olfr1 APN 11 73396019 start codon destroyed probably null 1.00
R0006:Olfr1 UTSW 11 73395488 missense probably damaging 0.99
R0907:Olfr1 UTSW 11 73395119 missense probably damaging 0.97
R1982:Olfr1 UTSW 11 73395092 missense probably benign 0.00
R3804:Olfr1 UTSW 11 73395950 missense probably benign 0.01
R4064:Olfr1 UTSW 11 73395522 missense probably benign 0.04
R4171:Olfr1 UTSW 11 73395539 missense probably damaging 1.00
R4724:Olfr1 UTSW 11 73395155 missense probably damaging 1.00
R4732:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R4733:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R5030:Olfr1 UTSW 11 73395654 frame shift probably null
R5097:Olfr1 UTSW 11 73395293 missense probably damaging 1.00
R5098:Olfr1 UTSW 11 73395654 frame shift probably null
R5101:Olfr1 UTSW 11 73395654 frame shift probably null
R5135:Olfr1 UTSW 11 73395654 frame shift probably null
R5137:Olfr1 UTSW 11 73395654 frame shift probably null
R5192:Olfr1 UTSW 11 73395654 frame shift probably null
R5193:Olfr1 UTSW 11 73395653 frame shift probably null
R5193:Olfr1 UTSW 11 73395654 frame shift probably null
R5197:Olfr1 UTSW 11 73395654 frame shift probably null
R5221:Olfr1 UTSW 11 73395654 frame shift probably null
R5222:Olfr1 UTSW 11 73395654 frame shift probably null
R5258:Olfr1 UTSW 11 73395654 frame shift probably null
R5297:Olfr1 UTSW 11 73395654 frame shift probably null
R5396:Olfr1 UTSW 11 73395654 frame shift probably null
R5398:Olfr1 UTSW 11 73395654 frame shift probably null
R5399:Olfr1 UTSW 11 73395654 frame shift probably null
R5432:Olfr1 UTSW 11 73395654 frame shift probably null
R5433:Olfr1 UTSW 11 73395654 frame shift probably null
R5531:Olfr1 UTSW 11 73395177 missense probably benign 0.26
R5634:Olfr1 UTSW 11 73395654 frame shift probably null
R5714:Olfr1 UTSW 11 73395361 unclassified probably null
R5812:Olfr1 UTSW 11 73395654 frame shift probably null
R5813:Olfr1 UTSW 11 73395654 frame shift probably null
R5814:Olfr1 UTSW 11 73395654 frame shift probably null
R5815:Olfr1 UTSW 11 73395654 frame shift probably null
R5913:Olfr1 UTSW 11 73395654 frame shift probably null
R5955:Olfr1 UTSW 11 73395654 frame shift probably null
R5956:Olfr1 UTSW 11 73395654 frame shift probably null
R5968:Olfr1 UTSW 11 73395192 missense possibly damaging 0.75
R6029:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6176:Olfr1 UTSW 11 73395654 frame shift probably null
R6177:Olfr1 UTSW 11 73395654 frame shift probably null
R6178:Olfr1 UTSW 11 73395654 frame shift probably null
R6196:Olfr1 UTSW 11 73395473 missense probably benign 0.08
R6995:Olfr1 UTSW 11 73395584 missense probably benign
R7035:Olfr1 UTSW 11 73395718 missense probably benign 0.00
R7470:Olfr1 UTSW 11 73395888 missense probably damaging 1.00
R7530:Olfr1 UTSW 11 73388363 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CATTAACACGGGTGTCAGAGC -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'
Posted On2016-07-22