Mutagenetix > Incidental Mutation

Incidental Mutation 'R5220:Galc'

402283

Institutional Source

Beutler Lab

Gene Symbol

Galc

Ensembl Gene

ENSMUSG00000021003

Gene Name

galactosylceramidase

Synonyms

Gacy, A930008M05Rik, 2310068B06Rik, galactocerebrosidase

MMRRC Submission

042793-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5220 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98202294-98259459 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to A at 98231413 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021390]

AlphaFold

P54818

Predicted Effect

probably null
Transcript: ENSMUST00000021390

SMART Domains

Protein: ENSMUSP00000021390
Gene: ENSMUSG00000021003

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_59	17	684	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000221063

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222379

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes galactosylceramidase, the lysosomal hydryolase involved in the catabolism of galactosylceramide. Mutations in this gene result in slow growth, tremors and hind leg weakness, collectively termed as the 'twitcher' phenotype. In humans, deficiency of this gene product causes a lysosomal storage disorder known as Krabbe disease. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for spontaneous and targeted mutations exhibit tremors, progressive weakness, wasting, both central and peripheral demyelination, massive accumulation of galactosylceramide, abnormal macrophages, and death by 4 months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 79,088,297	E250G	probably damaging	Het
Adgra1	A	G	7: 139,875,596	N380S	probably benign	Het
Ap3d1	G	A	10: 80,727,167	P160L	probably damaging	Het
Atg9a	C	T	1: 75,185,728	V505M	probably damaging	Het
Chsy3	A	T	18: 59,410,030	I747F	probably damaging	Het
Clec2g	A	G	6: 128,981,306	S100G	probably benign	Het
Cmya5	G	T	13: 93,092,296	P2095T	probably damaging	Het
Dcaf10	T	C	4: 45,373,909	W445R	possibly damaging	Het
Espl1	T	A	15: 102,298,577	L159M	probably benign	Het
Fam126a	A	C	5: 23,965,222	S376R	possibly damaging	Het
Fbxw8	T	C	5: 118,095,711	D285G	possibly damaging	Het
Fras1	C	T	5: 96,768,363	R3419W	probably damaging	Het
Ghdc	T	C	11: 100,769,717	E110G	probably damaging	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
H2-T24	T	C	17: 36,014,670	T309A	probably benign	Het
Helb	A	C	10: 120,101,486	F618V	probably damaging	Het
Ifi211	A	G	1: 173,907,696	F56L	probably damaging	Het
Kntc1	T	C	5: 123,812,097	F1988L	probably damaging	Het
Mapk13	G	A	17: 28,778,491	S361N	probably benign	Het
Mapk3	A	G	7: 126,764,236	I146V	probably benign	Het
Megf6	G	A	4: 154,253,838		probably null	Het
Mug1	G	T	6: 121,861,133	V441F	probably benign	Het
Mymk	A	G	2: 27,062,214	S173P	probably benign	Het
Nox4	A	G	7: 87,374,408	T501A	possibly damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr155	C	A	4: 43,854,624	S105Y	possibly damaging	Het
Olfr666	T	C	7: 104,892,897	T244A	possibly damaging	Het
Prkcb	C	A	7: 122,289,455	H37Q	probably damaging	Het
Rabggtb	A	G	3: 153,909,387	F189L	probably damaging	Het
Setd1b	T	C	5: 123,143,408	I75T	unknown	Het
Slc10a5	T	A	3: 10,335,088	R171*	probably null	Het
Slc12a4	A	G	8: 105,953,852	F211L	probably damaging	Het
Slc1a5	T	A	7: 16,793,834	W352R	probably damaging	Het
Slc22a27	C	G	19: 7,865,938	A359P	probably damaging	Het
St8sia4	A	G	1: 95,627,735	M190T	probably damaging	Het
Tmeff2	A	G	1: 50,979,317	M153V	probably benign	Het
Trappc12	T	C	12: 28,746,697	T279A	probably damaging	Het
Ubn1	G	T	16: 5,077,954	A955S	probably benign	Het
Usp24	T	A	4: 106,382,303	H1147Q	possibly damaging	Het
Vrk1	T	A	12: 106,073,606		probably null	Het
Zdhhc25	T	A	15: 88,601,162	Y233*	probably null	Het
Zfp109	A	G	7: 24,228,754	V418A	probably benign	Het

Other mutations in Galc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Galc	APN	12	98231422	missense	probably benign
IGL01287:Galc	APN	12	98246244	unclassified	probably benign
IGL01618:Galc	APN	12	98252081	missense	possibly damaging	0.92
IGL02125:Galc	APN	12	98231509	missense	probably damaging	1.00
IGL02274:Galc	APN	12	98254214	nonsense	probably null
IGL02392:Galc	APN	12	98207413	missense	probably damaging	0.99
IGL02478:Galc	APN	12	98213132	missense	possibly damaging	0.96
IGL02544:Galc	APN	12	98231442	missense	probably benign	0.27
IGL03268:Galc	APN	12	98222593	splice site	probably benign
IGL03327:Galc	APN	12	98207476	splice site	probably benign
Crabby2	UTSW	12	98234266	missense	probably damaging	1.00
Krabbe	UTSW	12	98222647	missense	probably damaging	1.00
lobster	UTSW	12	98246255	missense	probably null	0.84
quake	UTSW	12	98242714	missense	probably damaging	1.00
teeter	UTSW	12	98259162	missense	probably damaging	1.00
R0218:Galc	UTSW	12	98222647	missense	probably damaging	1.00
R0240:Galc	UTSW	12	98252034	missense	probably damaging	1.00
R0240:Galc	UTSW	12	98252034	missense	probably damaging	1.00
R0467:Galc	UTSW	12	98242645	missense	probably damaging	1.00
R1619:Galc	UTSW	12	98234304	missense	probably benign	0.00
R1763:Galc	UTSW	12	98234266	missense	probably damaging	1.00
R1832:Galc	UTSW	12	98234240	critical splice donor site	probably null
R1844:Galc	UTSW	12	98246297	splice site	probably null
R1996:Galc	UTSW	12	98252026	missense	probably damaging	1.00
R2010:Galc	UTSW	12	98254230	missense	possibly damaging	0.51
R2097:Galc	UTSW	12	98252032	missense	probably benign
R2496:Galc	UTSW	12	98227281	missense	probably damaging	1.00
R2881:Galc	UTSW	12	98213096	missense	probably benign
R3009:Galc	UTSW	12	98203969	missense	probably damaging	1.00
R4571:Galc	UTSW	12	98222617	missense	probably benign	0.00
R4764:Galc	UTSW	12	98242744	missense	possibly damaging	0.78
R4851:Galc	UTSW	12	98227274	missense	probably benign	0.00
R4854:Galc	UTSW	12	98256877	missense	probably damaging	1.00
R4900:Galc	UTSW	12	98231472	missense	probably damaging	1.00
R4983:Galc	UTSW	12	98242768	nonsense	probably null
R5273:Galc	UTSW	12	98252071	missense	probably damaging	1.00
R5495:Galc	UTSW	12	98231414	critical splice donor site	probably null
R5689:Galc	UTSW	12	98212986	missense	possibly damaging	0.94
R5819:Galc	UTSW	12	98216261	missense	probably benign	0.06
R6191:Galc	UTSW	12	98252034	missense	probably damaging	1.00
R6196:Galc	UTSW	12	98259162	missense	probably damaging	1.00
R6305:Galc	UTSW	12	98259290	missense	possibly damaging	0.57
R6335:Galc	UTSW	12	98242714	missense	probably damaging	1.00
R7255:Galc	UTSW	12	98246255	missense	probably null	0.84
R7496:Galc	UTSW	12	98259238	nonsense	probably null
R7704:Galc	UTSW	12	98208843	missense	probably benign
R8871:Galc	UTSW	12	98246284	missense	probably damaging	1.00
R9124:Galc	UTSW	12	98254164	critical splice donor site	probably null
R9140:Galc	UTSW	12	98207414	missense	probably null	0.55
R9211:Galc	UTSW	12	98207440	missense	probably benign	0.00
R9220:Galc	UTSW	12	98254264	missense	probably damaging	1.00
R9718:Galc	UTSW	12	98259314	missense

Predicted Primers

PCR Primer
(F):5'- GTACAAAATACAGAAAGCAATCAGGT -3'
(R):5'- TGGCAACATATATTTTGTTTGGTGTA -3'

Sequencing Primer
(F):5'- GTTTGTACAACCTCCTTTGG -3'
(R):5'- GAGTTGCCTTATGGACGAA -3'

Posted On

2016-07-22