Incidental Mutation 'R5220:Galc'
ID 402283
Institutional Source Beutler Lab
Gene Symbol Galc
Ensembl Gene ENSMUSG00000021003
Gene Name galactosylceramidase
Synonyms Gacy, A930008M05Rik, 2310068B06Rik, galactocerebrosidase
MMRRC Submission 042793-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5220 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 98202294-98259459 bp(-) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to A at 98231413 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021390]
AlphaFold P54818
Predicted Effect probably null
Transcript: ENSMUST00000021390
SMART Domains Protein: ENSMUSP00000021390
Gene: ENSMUSG00000021003

DomainStartEndE-ValueType
Pfam:Glyco_hydro_59 17 684 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000221063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222379
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes galactosylceramidase, the lysosomal hydryolase involved in the catabolism of galactosylceramide. Mutations in this gene result in slow growth, tremors and hind leg weakness, collectively termed as the 'twitcher' phenotype. In humans, deficiency of this gene product causes a lysosomal storage disorder known as Krabbe disease. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for spontaneous and targeted mutations exhibit tremors, progressive weakness, wasting, both central and peripheral demyelination, massive accumulation of galactosylceramide, abnormal macrophages, and death by 4 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,088,297 E250G probably damaging Het
Adgra1 A G 7: 139,875,596 N380S probably benign Het
Ap3d1 G A 10: 80,727,167 P160L probably damaging Het
Atg9a C T 1: 75,185,728 V505M probably damaging Het
Chsy3 A T 18: 59,410,030 I747F probably damaging Het
Clec2g A G 6: 128,981,306 S100G probably benign Het
Cmya5 G T 13: 93,092,296 P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 W445R possibly damaging Het
Espl1 T A 15: 102,298,577 L159M probably benign Het
Fam126a A C 5: 23,965,222 S376R possibly damaging Het
Fbxw8 T C 5: 118,095,711 D285G possibly damaging Het
Fras1 C T 5: 96,768,363 R3419W probably damaging Het
Ghdc T C 11: 100,769,717 E110G probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
H2-T24 T C 17: 36,014,670 T309A probably benign Het
Helb A C 10: 120,101,486 F618V probably damaging Het
Ifi211 A G 1: 173,907,696 F56L probably damaging Het
Kntc1 T C 5: 123,812,097 F1988L probably damaging Het
Mapk13 G A 17: 28,778,491 S361N probably benign Het
Mapk3 A G 7: 126,764,236 I146V probably benign Het
Megf6 G A 4: 154,253,838 probably null Het
Mug1 G T 6: 121,861,133 V441F probably benign Het
Mymk A G 2: 27,062,214 S173P probably benign Het
Nox4 A G 7: 87,374,408 T501A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 C A 4: 43,854,624 S105Y possibly damaging Het
Olfr666 T C 7: 104,892,897 T244A possibly damaging Het
Prkcb C A 7: 122,289,455 H37Q probably damaging Het
Rabggtb A G 3: 153,909,387 F189L probably damaging Het
Setd1b T C 5: 123,143,408 I75T unknown Het
Slc10a5 T A 3: 10,335,088 R171* probably null Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Slc1a5 T A 7: 16,793,834 W352R probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
St8sia4 A G 1: 95,627,735 M190T probably damaging Het
Tmeff2 A G 1: 50,979,317 M153V probably benign Het
Trappc12 T C 12: 28,746,697 T279A probably damaging Het
Ubn1 G T 16: 5,077,954 A955S probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Vrk1 T A 12: 106,073,606 probably null Het
Zdhhc25 T A 15: 88,601,162 Y233* probably null Het
Zfp109 A G 7: 24,228,754 V418A probably benign Het
Other mutations in Galc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Galc APN 12 98231422 missense probably benign
IGL01287:Galc APN 12 98246244 unclassified probably benign
IGL01618:Galc APN 12 98252081 missense possibly damaging 0.92
IGL02125:Galc APN 12 98231509 missense probably damaging 1.00
IGL02274:Galc APN 12 98254214 nonsense probably null
IGL02392:Galc APN 12 98207413 missense probably damaging 0.99
IGL02478:Galc APN 12 98213132 missense possibly damaging 0.96
IGL02544:Galc APN 12 98231442 missense probably benign 0.27
IGL03268:Galc APN 12 98222593 splice site probably benign
IGL03327:Galc APN 12 98207476 splice site probably benign
Crabby2 UTSW 12 98234266 missense probably damaging 1.00
Krabbe UTSW 12 98222647 missense probably damaging 1.00
lobster UTSW 12 98246255 missense probably null 0.84
quake UTSW 12 98242714 missense probably damaging 1.00
teeter UTSW 12 98259162 missense probably damaging 1.00
R0218:Galc UTSW 12 98222647 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0467:Galc UTSW 12 98242645 missense probably damaging 1.00
R1619:Galc UTSW 12 98234304 missense probably benign 0.00
R1763:Galc UTSW 12 98234266 missense probably damaging 1.00
R1832:Galc UTSW 12 98234240 critical splice donor site probably null
R1844:Galc UTSW 12 98246297 splice site probably null
R1996:Galc UTSW 12 98252026 missense probably damaging 1.00
R2010:Galc UTSW 12 98254230 missense possibly damaging 0.51
R2097:Galc UTSW 12 98252032 missense probably benign
R2496:Galc UTSW 12 98227281 missense probably damaging 1.00
R2881:Galc UTSW 12 98213096 missense probably benign
R3009:Galc UTSW 12 98203969 missense probably damaging 1.00
R4571:Galc UTSW 12 98222617 missense probably benign 0.00
R4764:Galc UTSW 12 98242744 missense possibly damaging 0.78
R4851:Galc UTSW 12 98227274 missense probably benign 0.00
R4854:Galc UTSW 12 98256877 missense probably damaging 1.00
R4900:Galc UTSW 12 98231472 missense probably damaging 1.00
R4983:Galc UTSW 12 98242768 nonsense probably null
R5273:Galc UTSW 12 98252071 missense probably damaging 1.00
R5495:Galc UTSW 12 98231414 critical splice donor site probably null
R5689:Galc UTSW 12 98212986 missense possibly damaging 0.94
R5819:Galc UTSW 12 98216261 missense probably benign 0.06
R6191:Galc UTSW 12 98252034 missense probably damaging 1.00
R6196:Galc UTSW 12 98259162 missense probably damaging 1.00
R6305:Galc UTSW 12 98259290 missense possibly damaging 0.57
R6335:Galc UTSW 12 98242714 missense probably damaging 1.00
R7255:Galc UTSW 12 98246255 missense probably null 0.84
R7496:Galc UTSW 12 98259238 nonsense probably null
R7704:Galc UTSW 12 98208843 missense probably benign
R8871:Galc UTSW 12 98246284 missense probably damaging 1.00
R9124:Galc UTSW 12 98254164 critical splice donor site probably null
R9140:Galc UTSW 12 98207414 missense probably null 0.55
R9211:Galc UTSW 12 98207440 missense probably benign 0.00
R9220:Galc UTSW 12 98254264 missense probably damaging 1.00
R9718:Galc UTSW 12 98259314 missense
Predicted Primers PCR Primer
(F):5'- GTACAAAATACAGAAAGCAATCAGGT -3'
(R):5'- TGGCAACATATATTTTGTTTGGTGTA -3'

Sequencing Primer
(F):5'- GTTTGTACAACCTCCTTTGG -3'
(R):5'- GAGTTGCCTTATGGACGAA -3'
Posted On 2016-07-22