Incidental Mutation 'R5220:Mapk13'
ID402290
Institutional Source Beutler Lab
Gene Symbol Mapk13
Ensembl Gene ENSMUSG00000004864
Gene Namemitogen-activated protein kinase 13
Synonymsp38 delta MAP kinase, SAPK4, Serk4
MMRRC Submission 042793-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R5220 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28769307-28778698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28778491 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 361 (S361N)
Ref Sequence ENSEMBL: ENSMUSP00000004986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004986] [ENSMUST00000129096]
Predicted Effect probably benign
Transcript: ENSMUST00000004986
AA Change: S361N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004986
Gene: ENSMUSG00000004864
AA Change: S361N

DomainStartEndE-ValueType
S_TKc 25 308 8.72e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124099
Predicted Effect probably benign
Transcript: ENSMUST00000129096
SMART Domains Protein: ENSMUSP00000115659
Gene: ENSMUSG00000004864

DomainStartEndE-ValueType
Pfam:Pkinase 25 209 1.1e-49 PFAM
Pfam:Pkinase_Tyr 27 210 2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133786
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein (MAP) kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The encoded protein is a p38 MAP kinase and is activated by proinflammatory cytokines and cellular stress. Substrates of the encoded protein include the transcription factor ATF2 and the microtubule dynamics regulator stathmin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit improved glucose tolerance, increased insulin secretion, decreased blood glucose, and decreased susceptibility to diet- or chemically-induced diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,088,297 E250G probably damaging Het
Adgra1 A G 7: 139,875,596 N380S probably benign Het
Ap3d1 G A 10: 80,727,167 P160L probably damaging Het
Atg9a C T 1: 75,185,728 V505M probably damaging Het
Chsy3 A T 18: 59,410,030 I747F probably damaging Het
Clec2g A G 6: 128,981,306 S100G probably benign Het
Cmya5 G T 13: 93,092,296 P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 W445R possibly damaging Het
Espl1 T A 15: 102,298,577 L159M probably benign Het
Fam126a A C 5: 23,965,222 S376R possibly damaging Het
Fbxw8 T C 5: 118,095,711 D285G possibly damaging Het
Fras1 C T 5: 96,768,363 R3419W probably damaging Het
Galc T A 12: 98,231,413 probably null Het
Ghdc T C 11: 100,769,717 E110G probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
H2-T24 T C 17: 36,014,670 T309A probably benign Het
Helb A C 10: 120,101,486 F618V probably damaging Het
Ifi211 A G 1: 173,907,696 F56L probably damaging Het
Kntc1 T C 5: 123,812,097 F1988L probably damaging Het
Mapk3 A G 7: 126,764,236 I146V probably benign Het
Megf6 G A 4: 154,253,838 probably null Het
Mug1 G T 6: 121,861,133 V441F probably benign Het
Mymk A G 2: 27,062,214 S173P probably benign Het
Nox4 A G 7: 87,374,408 T501A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 C A 4: 43,854,624 S105Y possibly damaging Het
Olfr666 T C 7: 104,892,897 T244A possibly damaging Het
Prkcb C A 7: 122,289,455 H37Q probably damaging Het
Rabggtb A G 3: 153,909,387 F189L probably damaging Het
Setd1b T C 5: 123,143,408 I75T unknown Het
Slc10a5 T A 3: 10,335,088 R171* probably null Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Slc1a5 T A 7: 16,793,834 W352R probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
St8sia4 A G 1: 95,627,735 M190T probably damaging Het
Tmeff2 A G 1: 50,979,317 M153V probably benign Het
Trappc12 T C 12: 28,746,697 T279A probably damaging Het
Ubn1 G T 16: 5,077,954 A955S probably benign Het
Usp24 T A 4: 106,382,303 H1147Q possibly damaging Het
Vrk1 T A 12: 106,073,606 probably null Het
Zdhhc25 T A 15: 88,601,162 Y233* probably null Het
Zfp109 A G 7: 24,228,754 V418A probably benign Het
Other mutations in Mapk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Mapk13 APN 17 28776405 missense probably damaging 1.00
IGL01918:Mapk13 APN 17 28775330 missense probably damaging 1.00
IGL02265:Mapk13 APN 17 28777718 splice site probably benign
IGL02451:Mapk13 APN 17 28776413 missense probably damaging 1.00
IGL02977:Mapk13 APN 17 28776348 missense probably damaging 1.00
IGL03118:Mapk13 APN 17 28777735 missense probably benign 0.14
IGL03188:Mapk13 APN 17 28776583 intron probably benign
R0501:Mapk13 UTSW 17 28776353 missense probably damaging 1.00
R0538:Mapk13 UTSW 17 28775255 missense probably damaging 1.00
R2240:Mapk13 UTSW 17 28778111 missense probably damaging 0.98
R4368:Mapk13 UTSW 17 28777565 splice site probably null
R4613:Mapk13 UTSW 17 28769452 missense probably damaging 1.00
R4649:Mapk13 UTSW 17 28778487 nonsense probably null
R4684:Mapk13 UTSW 17 28770049 missense probably damaging 1.00
R4796:Mapk13 UTSW 17 28775554 missense probably damaging 1.00
R4863:Mapk13 UTSW 17 28776310 missense probably damaging 1.00
R4923:Mapk13 UTSW 17 28778223 missense probably benign
R5247:Mapk13 UTSW 17 28777751 missense probably benign 0.01
R5370:Mapk13 UTSW 17 28776352 nonsense probably null
R6838:Mapk13 UTSW 17 28777561 splice site probably null
R6843:Mapk13 UTSW 17 28775453 intron probably null
R7187:Mapk13 UTSW 17 28776387 missense probably damaging 1.00
Z1088:Mapk13 UTSW 17 28777533 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TAGCTGTCCATCTCCTGTGG -3'
(R):5'- TGCCTGAGTTTGAGAGATGC -3'

Sequencing Primer
(F):5'- GTCCATCTCCTGTGGGGTTTTC -3'
(R):5'- AGTGGTGCATGCCTTTAATCC -3'
Posted On2016-07-22