Incidental Mutation 'R5221:Rrh'
ID402304
Institutional Source Beutler Lab
Gene Symbol Rrh
Ensembl Gene ENSMUSG00000028012
Gene Nameretinal pigment epithelium derived rhodopsin homolog
SynonymsPeropsin
MMRRC Submission 042794-MU
Accession Numbers

Genbank: NM_009102.3; Ensembl: ENSMUST00000029648, ENSMUST00000078035 ,ENSMUST00000090295, ENSMUST00000171313

Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5221 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location129804408-129822587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129815631 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 69 (S69G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029648] [ENSMUST00000171313] [ENSMUST00000196902] [ENSMUST00000200079]
Predicted Effect probably benign
Transcript: ENSMUST00000029648
AA Change: S76G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029648
Gene: ENSMUSG00000028012
AA Change: S76G

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 1.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171313
AA Change: S76G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132360
Gene: ENSMUSG00000028012
AA Change: S76G

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 4.6e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196317
Predicted Effect probably benign
Transcript: ENSMUST00000196902
AA Change: S76G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143093
Gene: ENSMUSG00000028012
AA Change: S76G

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 1.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197295
Predicted Effect probably damaging
Transcript: ENSMUST00000197535
AA Change: S69G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000200079
SMART Domains Protein: ENSMUSP00000143054
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7tm_1 30 197 3.1e-22 PFAM
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. This gene belongs to the seven-exon subfamily of mammalian opsin genes that includes opsin 5 and retinal G protein coupled receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap26 T A 18: 39,110,472 Y134* probably null Het
Asap2 A G 12: 21,213,190 I269V probably benign Het
BC037034 C T 5: 138,262,240 S308N probably benign Het
Bean1 A T 8: 104,215,152 D34V probably damaging Het
C8a C T 4: 104,845,925 V312M probably damaging Het
Ccser1 T C 6: 61,312,091 S413P probably damaging Het
Col4a2 A G 8: 11,448,225 N1678S probably benign Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Dsg1a T A 18: 20,324,014 M148K possibly damaging Het
Fam173a T C 17: 25,791,639 N67S possibly damaging Het
Farp2 T A 1: 93,576,418 C306S probably damaging Het
Frem2 A G 3: 53,585,611 V1828A probably damaging Het
Gm6457 T C 18: 14,570,117 noncoding transcript Het
Gm8979 G C 7: 106,083,974 noncoding transcript Het
Gm9268 T A 7: 43,023,260 H106Q probably benign Het
Gm9774 T C 3: 92,428,508 I296V probably benign Het
Gmip T G 8: 69,814,135 V300G probably damaging Het
Gstp3 A G 19: 4,057,607 S186P probably damaging Het
Kl G T 5: 150,989,151 L788F probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrp1b A C 2: 41,112,982 S1932A possibly damaging Het
Lrrc36 A G 8: 105,443,856 T234A probably damaging Het
Mafa T A 15: 75,747,042 Q294L possibly damaging Het
Mesp2 C T 7: 79,811,719 T264I possibly damaging Het
Mindy4 A G 6: 55,224,107 Y259C probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1026 A G 2: 85,924,149 N294D probably damaging Het
Olfr1111 T C 2: 87,150,481 Y60C probably damaging Het
Olfr709-ps1 A T 7: 106,927,061 S133T probably benign Het
Olfr912 A T 9: 38,581,852 T192S probably damaging Het
Pcm1 T C 8: 41,288,156 probably null Het
Plxna1 T C 6: 89,321,016 D1760G probably damaging Het
Polq T A 16: 37,042,178 D345E probably damaging Het
Ppp1r14a T A 7: 29,289,501 I56N probably damaging Het
Ppp1r1a G A 15: 103,533,050 P79S probably damaging Het
Ptprf C T 4: 118,225,108 R1010H probably benign Het
Rai1 A G 11: 60,190,597 E1829G probably damaging Het
Rmdn3 A G 2: 119,156,454 Y31H probably damaging Het
Skint6 A T 4: 112,894,924 probably null Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Sltm T G 9: 70,579,403 L450R probably damaging Het
Sufu T C 19: 46,450,965 probably null Het
Tmem68 T C 4: 3,560,561 T208A possibly damaging Het
Tnc T A 4: 63,993,297 R1346* probably null Het
Tpbg T C 9: 85,844,425 L149P probably damaging Het
Ubtf G A 11: 102,307,990 Q585* probably null Het
Vmn2r68 A T 7: 85,221,877 C733S probably damaging Het
Wscd1 G T 11: 71,768,675 G194W possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp462 T A 4: 55,016,887 V870E possibly damaging Het
Other mutations in Rrh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Rrh APN 3 129822425 missense possibly damaging 0.53
IGL01368:Rrh APN 3 129808969 missense probably benign 0.02
IGL02206:Rrh APN 3 129811697 missense probably benign 0.40
IGL02577:Rrh APN 3 129815723 missense probably damaging 0.98
B6584:Rrh UTSW 3 129811742 missense probably damaging 1.00
R1822:Rrh UTSW 3 129812633 missense probably damaging 0.99
R2114:Rrh UTSW 3 129810687 missense probably damaging 1.00
R2115:Rrh UTSW 3 129810687 missense probably damaging 1.00
R2116:Rrh UTSW 3 129810687 missense probably damaging 1.00
R2484:Rrh UTSW 3 129822391 missense probably damaging 1.00
R2913:Rrh UTSW 3 129815609 missense probably damaging 0.99
R3236:Rrh UTSW 3 129811711 missense probably damaging 1.00
R3237:Rrh UTSW 3 129811711 missense probably damaging 1.00
R5270:Rrh UTSW 3 129813349 missense probably benign 0.05
R7036:Rrh UTSW 3 129815693 missense possibly damaging 0.54
R7334:Rrh UTSW 3 129808982 missense probably benign 0.00
R7339:Rrh UTSW 3 129810613 missense probably damaging 1.00
R7779:Rrh UTSW 3 129815320 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCCCACAGCAACCAGTGTC -3'
(R):5'- GAGCTTGCTCTCTTTTGAAGC -3'

Sequencing Primer
(F):5'- AGCAACCAGTGTCCCCGTTG -3'
(R):5'- AGCTTGCTCTCTTTTGAAGCAACTTC -3'
Posted On2016-07-22