Incidental Mutation 'R5221:BC037034'
ID402311
Institutional Source Beutler Lab
Gene Symbol BC037034
Ensembl Gene ENSMUSG00000036948
Gene NamecDNA sequence BC037034
Synonyms
MMRRC Submission 042794-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5221 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138259656-138264033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138262240 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 308 (S308N)
Ref Sequence ENSEMBL: ENSMUSP00000046898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048421] [ENSMUST00000062067] [ENSMUST00000100530] [ENSMUST00000159067] [ENSMUST00000159123] [ENSMUST00000159146] [ENSMUST00000159649] [ENSMUST00000161279] [ENSMUST00000161647]
Predicted Effect probably benign
Transcript: ENSMUST00000048421
AA Change: S308N

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000046898
Gene: ENSMUSG00000036948
AA Change: S308N

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
low complexity region 215 225 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062067
Predicted Effect probably benign
Transcript: ENSMUST00000100530
SMART Domains Protein: ENSMUSP00000098099
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144460
Predicted Effect probably benign
Transcript: ENSMUST00000159067
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159123
SMART Domains Protein: ENSMUSP00000137679
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159534
Predicted Effect probably benign
Transcript: ENSMUST00000159649
AA Change: S39N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125208
Gene: ENSMUSG00000036948
AA Change: S39N

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160157
Predicted Effect probably benign
Transcript: ENSMUST00000161279
SMART Domains Protein: ENSMUSP00000124841
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161647
SMART Domains Protein: ENSMUSP00000125084
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 4 226 5.3e-58 PFAM
Pfam:Gal-3-0_sulfotr 265 458 3.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162632
Predicted Effect probably benign
Transcript: ENSMUST00000163268
AA Change: S39N

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127072
Gene: ENSMUSG00000091964
AA Change: S39N

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap26 T A 18: 39,110,472 Y134* probably null Het
Asap2 A G 12: 21,213,190 I269V probably benign Het
Bean1 A T 8: 104,215,152 D34V probably damaging Het
C8a C T 4: 104,845,925 V312M probably damaging Het
Ccser1 T C 6: 61,312,091 S413P probably damaging Het
Col4a2 A G 8: 11,448,225 N1678S probably benign Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Dsg1a T A 18: 20,324,014 M148K possibly damaging Het
Fam173a T C 17: 25,791,639 N67S possibly damaging Het
Farp2 T A 1: 93,576,418 C306S probably damaging Het
Frem2 A G 3: 53,585,611 V1828A probably damaging Het
Gm6457 T C 18: 14,570,117 noncoding transcript Het
Gm8979 G C 7: 106,083,974 noncoding transcript Het
Gm9268 T A 7: 43,023,260 H106Q probably benign Het
Gm9774 T C 3: 92,428,508 I296V probably benign Het
Gmip T G 8: 69,814,135 V300G probably damaging Het
Gstp3 A G 19: 4,057,607 S186P probably damaging Het
Kl G T 5: 150,989,151 L788F probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrp1b A C 2: 41,112,982 S1932A possibly damaging Het
Lrrc36 A G 8: 105,443,856 T234A probably damaging Het
Mafa T A 15: 75,747,042 Q294L possibly damaging Het
Mesp2 C T 7: 79,811,719 T264I possibly damaging Het
Mindy4 A G 6: 55,224,107 Y259C probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1026 A G 2: 85,924,149 N294D probably damaging Het
Olfr1111 T C 2: 87,150,481 Y60C probably damaging Het
Olfr709-ps1 A T 7: 106,927,061 S133T probably benign Het
Olfr912 A T 9: 38,581,852 T192S probably damaging Het
Pcm1 T C 8: 41,288,156 probably null Het
Plxna1 T C 6: 89,321,016 D1760G probably damaging Het
Polq T A 16: 37,042,178 D345E probably damaging Het
Ppp1r14a T A 7: 29,289,501 I56N probably damaging Het
Ppp1r1a G A 15: 103,533,050 P79S probably damaging Het
Ptprf C T 4: 118,225,108 R1010H probably benign Het
Rai1 A G 11: 60,190,597 E1829G probably damaging Het
Rmdn3 A G 2: 119,156,454 Y31H probably damaging Het
Rrh T C 3: 129,815,631 S69G probably damaging Het
Skint6 A T 4: 112,894,924 probably null Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Sltm T G 9: 70,579,403 L450R probably damaging Het
Sufu T C 19: 46,450,965 probably null Het
Tmem68 T C 4: 3,560,561 T208A possibly damaging Het
Tnc T A 4: 63,993,297 R1346* probably null Het
Tpbg T C 9: 85,844,425 L149P probably damaging Het
Ubtf G A 11: 102,307,990 Q585* probably null Het
Vmn2r68 A T 7: 85,221,877 C733S probably damaging Het
Wscd1 G T 11: 71,768,675 G194W possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp462 T A 4: 55,016,887 V870E possibly damaging Het
Other mutations in BC037034
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:BC037034 APN 5 138261705 missense possibly damaging 0.46
IGL01617:BC037034 APN 5 138262216 missense probably damaging 1.00
IGL02256:BC037034 APN 5 138260315 missense probably damaging 0.99
IGL02493:BC037034 APN 5 138263170 unclassified probably null
IGL02904:BC037034 APN 5 138260602 missense probably benign 0.04
IGL03151:BC037034 APN 5 138262672 missense possibly damaging 0.95
R0005:BC037034 UTSW 5 138262654 splice site probably null
R0010:BC037034 UTSW 5 138260293 unclassified probably null
R0010:BC037034 UTSW 5 138260293 unclassified probably null
R0619:BC037034 UTSW 5 138263826 unclassified probably benign
R0630:BC037034 UTSW 5 138262289 missense probably damaging 0.98
R1579:BC037034 UTSW 5 138261866 missense probably benign 0.00
R1778:BC037034 UTSW 5 138262477 unclassified probably null
R1816:BC037034 UTSW 5 138260341 missense possibly damaging 0.91
R2009:BC037034 UTSW 5 138260929 missense probably damaging 1.00
R4711:BC037034 UTSW 5 138262905 unclassified probably benign
R4923:BC037034 UTSW 5 138262379 unclassified probably benign
R4999:BC037034 UTSW 5 138261622 missense probably damaging 1.00
R5103:BC037034 UTSW 5 138262300 missense probably benign 0.15
R5444:BC037034 UTSW 5 138260998 unclassified probably null
R5720:BC037034 UTSW 5 138263702 missense probably benign 0.00
R6519:BC037034 UTSW 5 138261848 missense probably damaging 0.99
R6599:BC037034 UTSW 5 138263458 unclassified probably null
R6918:BC037034 UTSW 5 138260664 missense probably benign 0.03
R7275:BC037034 UTSW 5 138263577 missense probably benign 0.18
R7460:BC037034 UTSW 5 138262729 missense probably benign 0.32
R7564:BC037034 UTSW 5 138262842 splice site probably null
Predicted Primers PCR Primer
(F):5'- GACTTGGGATGTTCAGAGGCTC -3'
(R):5'- CTGCTGGTGGACAATGTCTG -3'

Sequencing Primer
(F):5'- CTCATATAGCTGGGGATGACC -3'
(R):5'- GGACAATGTCTGGTGAGGTTC -3'
Posted On2016-07-22