Incidental Mutation 'R5221:Vmn2r68'
ID402319
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Namevomeronasal 2, receptor 68
SynonymsVmn2r68-ps, EG620697
MMRRC Submission 042794-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5221 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85221518-85237704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85221877 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 733 (C733S)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
Predicted Effect probably damaging
Transcript: ENSMUST00000061074
AA Change: C733S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: C733S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap26 T A 18: 39,110,472 Y134* probably null Het
Asap2 A G 12: 21,213,190 I269V probably benign Het
BC037034 C T 5: 138,262,240 S308N probably benign Het
Bean1 A T 8: 104,215,152 D34V probably damaging Het
C8a C T 4: 104,845,925 V312M probably damaging Het
Ccser1 T C 6: 61,312,091 S413P probably damaging Het
Col4a2 A G 8: 11,448,225 N1678S probably benign Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Dsg1a T A 18: 20,324,014 M148K possibly damaging Het
Fam173a T C 17: 25,791,639 N67S possibly damaging Het
Farp2 T A 1: 93,576,418 C306S probably damaging Het
Frem2 A G 3: 53,585,611 V1828A probably damaging Het
Gm6457 T C 18: 14,570,117 noncoding transcript Het
Gm8979 G C 7: 106,083,974 noncoding transcript Het
Gm9268 T A 7: 43,023,260 H106Q probably benign Het
Gm9774 T C 3: 92,428,508 I296V probably benign Het
Gmip T G 8: 69,814,135 V300G probably damaging Het
Gstp3 A G 19: 4,057,607 S186P probably damaging Het
Kl G T 5: 150,989,151 L788F probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrp1b A C 2: 41,112,982 S1932A possibly damaging Het
Lrrc36 A G 8: 105,443,856 T234A probably damaging Het
Mafa T A 15: 75,747,042 Q294L possibly damaging Het
Mesp2 C T 7: 79,811,719 T264I possibly damaging Het
Mindy4 A G 6: 55,224,107 Y259C probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1026 A G 2: 85,924,149 N294D probably damaging Het
Olfr1111 T C 2: 87,150,481 Y60C probably damaging Het
Olfr709-ps1 A T 7: 106,927,061 S133T probably benign Het
Olfr912 A T 9: 38,581,852 T192S probably damaging Het
Pcm1 T C 8: 41,288,156 probably null Het
Plxna1 T C 6: 89,321,016 D1760G probably damaging Het
Polq T A 16: 37,042,178 D345E probably damaging Het
Ppp1r14a T A 7: 29,289,501 I56N probably damaging Het
Ppp1r1a G A 15: 103,533,050 P79S probably damaging Het
Ptprf C T 4: 118,225,108 R1010H probably benign Het
Rai1 A G 11: 60,190,597 E1829G probably damaging Het
Rmdn3 A G 2: 119,156,454 Y31H probably damaging Het
Rrh T C 3: 129,815,631 S69G probably damaging Het
Skint6 A T 4: 112,894,924 probably null Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Sltm T G 9: 70,579,403 L450R probably damaging Het
Sufu T C 19: 46,450,965 probably null Het
Tmem68 T C 4: 3,560,561 T208A possibly damaging Het
Tnc T A 4: 63,993,297 R1346* probably null Het
Tpbg T C 9: 85,844,425 L149P probably damaging Het
Ubtf G A 11: 102,307,990 Q585* probably null Het
Wscd1 G T 11: 71,768,675 G194W possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp462 T A 4: 55,016,887 V870E possibly damaging Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85233894 missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2185:Vmn2r68 UTSW 7 85233693 nonsense probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R3978:Vmn2r68 UTSW 7 85232462 missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85222075 missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 85222252 missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 85233834 missense probably benign
R7374:Vmn2r68 UTSW 7 85232399 missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 85232379 missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85233908 missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 85234514 missense probably benign
R7975:Vmn2r68 UTSW 7 85234514 missense probably benign
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGATGAAAGTAATCCAGACACTGC -3'
(R):5'- GATTGCTTTCACTGTGGCTACC -3'

Sequencing Primer
(F):5'- TGCAGAACACCAACATGCTGAATG -3'
(R):5'- GGCTACCTCTACTATCTTGGCTAAG -3'
Posted On2016-07-22