Mutagenetix > Incidental Mutations

Incidental Mutation 'R5221:Col4a2'

402322

Institutional Source

Beutler Lab

Gene Symbol

Col4a2

Ensembl Gene

ENSMUSG00000031503

Gene Name

collagen, type IV, alpha 2

Synonyms

Col4a-2

MMRRC Submission

042794-MU

Accession Numbers

Genbank: NM_009932

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5221 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11312805-11449287 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11448225 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1678 (N1678S)

Ref Sequence

ENSEMBL: ENSMUSP00000033899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033899]

Predicted Effect

probably benign
Transcript: ENSMUST00000033899
AA Change: N1678S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000033899
Gene: ENSMUSG00000031503
AA Change: N1678S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Collagen	56	119	1.2e-10	PFAM
Pfam:Collagen	112	174	3.9e-8	PFAM
low complexity region	193	229	N/A	INTRINSIC
Pfam:Collagen	289	348	1.3e-10	PFAM
low complexity region	370	389	N/A	INTRINSIC
low complexity region	427	445	N/A	INTRINSIC
Pfam:Collagen	488	546	2e-10	PFAM
Pfam:Collagen	590	655	4.5e-9	PFAM
low complexity region	665	673	N/A	INTRINSIC
Pfam:Collagen	674	731	3.5e-10	PFAM
Pfam:Collagen	714	775	4.3e-10	PFAM
Pfam:Collagen	773	831	1.5e-10	PFAM
Pfam:Collagen	861	935	8.1e-10	PFAM
Pfam:Collagen	915	976	1.1e-9	PFAM
Pfam:Collagen	978	1038	2.6e-8	PFAM
Pfam:Collagen	1027	1091	1.7e-10	PFAM
Pfam:Collagen	1094	1155	5.5e-11	PFAM
Pfam:Collagen	1147	1211	1e-10	PFAM
Pfam:Collagen	1271	1340	2.1e-8	PFAM
Pfam:Collagen	1330	1392	7.1e-10	PFAM
C4	1484	1591	7.85e-59	SMART
C4	1592	1706	7.65e-71	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146219

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: This gene encodes the alpha-2 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of alpha-1 and alpha-2 subunits that assembles into a type IV collagen network. Canstatin, a peptide derived fom the C-terminus of the collagen chain, is a matrikine that has been shown to inhibit angiogenesis. Homozygous knockout mice for this gene exhibit impaired basement membrane integrity and embryonic lethality. This gene shares a bi-directional promoter with a related gene on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: ENU-induced missense mutations of this gene result in a variable phenotype affecting the eye, brain and vascular stability in heterozygotes, and fetal or postnatal survival in homozygotes. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(6) Chemically induced(3)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap26	T	A	18: 39,110,472	Y134*	probably null	Het
Asap2	A	G	12: 21,213,190	I269V	probably benign	Het
BC037034	C	T	5: 138,262,240	S308N	probably benign	Het
Bean1	A	T	8: 104,215,152	D34V	probably damaging	Het
C8a	C	T	4: 104,845,925	V312M	probably damaging	Het
Ccser1	T	C	6: 61,312,091	S413P	probably damaging	Het
Coq2	G	A	5: 100,657,832	H313Y	possibly damaging	Het
Dsg1a	T	A	18: 20,324,014	M148K	possibly damaging	Het
Fam173a	T	C	17: 25,791,639	N67S	possibly damaging	Het
Farp2	T	A	1: 93,576,418	C306S	probably damaging	Het
Frem2	A	G	3: 53,585,611	V1828A	probably damaging	Het
Gm6457	T	C	18: 14,570,117		noncoding transcript	Het
Gm8979	G	C	7: 106,083,974		noncoding transcript	Het
Gm9268	T	A	7: 43,023,260	H106Q	probably benign	Het
Gm9774	T	C	3: 92,428,508	I296V	probably benign	Het
Gmip	T	G	8: 69,814,135	V300G	probably damaging	Het
Gstp3	A	G	19: 4,057,607	S186P	probably damaging	Het
Kl	G	T	5: 150,989,151	L788F	probably damaging	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lrp1b	A	C	2: 41,112,982	S1932A	possibly damaging	Het
Lrrc36	A	G	8: 105,443,856	T234A	probably damaging	Het
Mafa	T	A	15: 75,747,042	Q294L	possibly damaging	Het
Mesp2	C	T	7: 79,811,719	T264I	possibly damaging	Het
Mindy4	A	G	6: 55,224,107	Y259C	probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1026	A	G	2: 85,924,149	N294D	probably damaging	Het
Olfr1111	T	C	2: 87,150,481	Y60C	probably damaging	Het
Olfr709-ps1	A	T	7: 106,927,061	S133T	probably benign	Het
Olfr912	A	T	9: 38,581,852	T192S	probably damaging	Het
Pcm1	T	C	8: 41,288,156		probably null	Het
Plxna1	T	C	6: 89,321,016	D1760G	probably damaging	Het
Polq	T	A	16: 37,042,178	D345E	probably damaging	Het
Ppp1r14a	T	A	7: 29,289,501	I56N	probably damaging	Het
Ppp1r1a	G	A	15: 103,533,050	P79S	probably damaging	Het
Ptprf	C	T	4: 118,225,108	R1010H	probably benign	Het
Rai1	A	G	11: 60,190,597	E1829G	probably damaging	Het
Rmdn3	A	G	2: 119,156,454	Y31H	probably damaging	Het
Rrh	T	C	3: 129,815,631	S69G	probably damaging	Het
Skint6	A	T	4: 112,894,924		probably null	Het
Slc22a27	C	G	19: 7,865,938	A359P	probably damaging	Het
Sltm	T	G	9: 70,579,403	L450R	probably damaging	Het
Sufu	T	C	19: 46,450,965		probably null	Het
Tmem68	T	C	4: 3,560,561	T208A	possibly damaging	Het
Tnc	T	A	4: 63,993,297	R1346*	probably null	Het
Tpbg	T	C	9: 85,844,425	L149P	probably damaging	Het
Ubtf	G	A	11: 102,307,990	Q585*	probably null	Het
Vmn2r68	A	T	7: 85,221,877	C733S	probably damaging	Het
Wscd1	G	T	11: 71,768,675	G194W	possibly damaging	Het
Zfp354b	A	C	11: 50,923,090	I336S	probably benign	Het
Zfp462	T	A	4: 55,016,887	V870E	possibly damaging	Het

Other mutations in Col4a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Col4a2	APN	8	11443685	missense	probably damaging	1.00
IGL00485:Col4a2	APN	8	11439012	missense	probably benign
IGL00909:Col4a2	APN	8	11448167	missense	possibly damaging	0.91
IGL01574:Col4a2	APN	8	11439306	missense	probably damaging	1.00
IGL01914:Col4a2	APN	8	11414754	missense	possibly damaging	0.57
IGL02147:Col4a2	APN	8	11408140	missense	probably benign	0.28
IGL02205:Col4a2	APN	8	11431305	nonsense	probably null
IGL02423:Col4a2	APN	8	11433800	missense	probably benign
IGL03131:Col4a2	APN	8	11425979	missense	probably benign
band	UTSW	8	11448225	missense	probably benign	0.00
binder	UTSW	8	11416070	missense	probably damaging	1.00
G4846:Col4a2	UTSW	8	11408872	splice site	probably benign
IGL03054:Col4a2	UTSW	8	11448270	missense	probably damaging	0.96
R0087:Col4a2	UTSW	8	11441296	missense	probably benign
R0124:Col4a2	UTSW	8	11408871	splice site	probably benign
R0603:Col4a2	UTSW	8	11414779	missense	probably benign
R0646:Col4a2	UTSW	8	11431252	missense	probably benign	0.17
R0970:Col4a2	UTSW	8	11415438	missense	probably benign	0.00
R1738:Col4a2	UTSW	8	11446238	missense	probably damaging	1.00
R1746:Col4a2	UTSW	8	11446020	missense	probably benign	0.35
R1826:Col4a2	UTSW	8	11313509	critical splice donor site	probably null
R1834:Col4a2	UTSW	8	11402997	missense	probably benign	0.10
R2016:Col4a2	UTSW	8	11445086	missense	probably benign	0.04
R2017:Col4a2	UTSW	8	11445086	missense	probably benign	0.04
R2124:Col4a2	UTSW	8	11416070	missense	probably damaging	1.00
R2137:Col4a2	UTSW	8	11433749	missense	probably benign
R2207:Col4a2	UTSW	8	11443352	missense	probably damaging	1.00
R3156:Col4a2	UTSW	8	11313414	unclassified	probably benign
R4169:Col4a2	UTSW	8	11429391	missense	probably benign	0.22
R4679:Col4a2	UTSW	8	11431337	missense	possibly damaging	0.68
R4705:Col4a2	UTSW	8	11313504	missense	possibly damaging	0.52
R4710:Col4a2	UTSW	8	11409462	missense	probably benign	0.22
R4716:Col4a2	UTSW	8	11402224	missense	probably damaging	1.00
R4730:Col4a2	UTSW	8	11437590	missense	probably benign
R4732:Col4a2	UTSW	8	11414779	missense	probably benign
R4732:Col4a2	UTSW	8	11446197	missense	probably benign	0.02
R4733:Col4a2	UTSW	8	11414779	missense	probably benign
R4733:Col4a2	UTSW	8	11446197	missense	probably benign	0.02
R4834:Col4a2	UTSW	8	11406836	nonsense	probably null
R4835:Col4a2	UTSW	8	11423570	nonsense	probably null
R4953:Col4a2	UTSW	8	11429505	missense	probably benign	0.02
R5078:Col4a2	UTSW	8	11443936	missense	probably benign
R5204:Col4a2	UTSW	8	11398651	splice site	probably null
R5355:Col4a2	UTSW	8	11445984	missense	probably damaging	0.96
R5478:Col4a2	UTSW	8	11398697	missense	probably benign	0.21
R5492:Col4a2	UTSW	8	11438608	missense	possibly damaging	0.82
R5646:Col4a2	UTSW	8	11441281	missense	probably damaging	1.00
R5857:Col4a2	UTSW	8	11425442	missense	probably damaging	1.00
R5948:Col4a2	UTSW	8	11420600	missense	probably benign	0.21
R6329:Col4a2	UTSW	8	11446238	missense	probably damaging	1.00
R6496:Col4a2	UTSW	8	11402993	nonsense	probably null
R6496:Col4a2	UTSW	8	11402994	missense	probably damaging	1.00
R6531:Col4a2	UTSW	8	11408135	missense	probably benign	0.00
R7185:Col4a2	UTSW	8	11399739	missense	probably damaging	0.99
R7196:Col4a2	UTSW	8	11398693	missense	probably damaging	1.00
R7266:Col4a2	UTSW	8	11425542	critical splice donor site	probably null
R7308:Col4a2	UTSW	8	11406856	critical splice donor site	probably null
R7341:Col4a2	UTSW	8	11398678	missense	probably damaging	0.97
R7394:Col4a2	UTSW	8	11446184	missense	probably benign	0.00
R7434:Col4a2	UTSW	8	11421250	missense	probably damaging	1.00
R7606:Col4a2	UTSW	8	11443571	missense	probably benign	0.00
R7646:Col4a2	UTSW	8	11445086	missense	probably benign	0.04
R7712:Col4a2	UTSW	8	11425376	missense	probably benign
R7752:Col4a2	UTSW	8	11429358	missense	probably benign	0.38
R7844:Col4a2	UTSW	8	11425453	nonsense	probably null
R7901:Col4a2	UTSW	8	11429358	missense	probably benign	0.38
R8186:Col4a2	UTSW	8	11425542	critical splice donor site	probably null
R8331:Col4a2	UTSW	8	11413985	nonsense	probably null
R8389:Col4a2	UTSW	8	11448132	missense	probably damaging	1.00
R8547:Col4a2	UTSW	8	11429305	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGGCATGTGACCTCTAACAC -3'
(R):5'- TTTGGGATCAGCATCTGAGG -3'

Sequencing Primer
(F):5'- TGTGACCTCTAACACACTTCATC -3'
(R):5'- TTACATAGTTCCAGGCTAGGCAG -3'

Posted On

2016-07-22