Incidental Mutation 'R5221:Bean1'
ID 402325
Institutional Source Beutler Lab
Gene Symbol Bean1
Ensembl Gene ENSMUSG00000031872
Gene Name brain expressed, associated with Nedd4, 1
Synonyms
MMRRC Submission 042794-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5221 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 104897110-104945730 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104941784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 34 (D34V)
Ref Sequence ENSEMBL: ENSMUSP00000148283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]
AlphaFold Q9EQG5
Predicted Effect probably damaging
Transcript: ENSMUST00000093245
AA Change: D139V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872
AA Change: D139V

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164076
AA Change: D78V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872
AA Change: D78V

DomainStartEndE-ValueType
low complexity region 156 171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167633
AA Change: D139V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872
AA Change: D139V

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171018
AA Change: D210V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872
AA Change: D210V

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 104 124 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212627
Predicted Effect probably damaging
Transcript: ENSMUST00000212979
AA Change: D210V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213077
AA Change: D34V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1381 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1b T C 3: 92,335,815 (GRCm39) I296V probably benign Het
Antkmt T C 17: 26,010,613 (GRCm39) N67S possibly damaging Het
Arhgap26 T A 18: 39,243,525 (GRCm39) Y134* probably null Het
Asap2 A G 12: 21,263,191 (GRCm39) I269V probably benign Het
C8a C T 4: 104,703,122 (GRCm39) V312M probably damaging Het
Ccser1 T C 6: 61,289,075 (GRCm39) S413P probably damaging Het
Col4a2 A G 8: 11,498,225 (GRCm39) N1678S probably benign Het
Coq2 G A 5: 100,805,698 (GRCm39) H313Y possibly damaging Het
Dsg1a T A 18: 20,457,071 (GRCm39) M148K possibly damaging Het
Farp2 T A 1: 93,504,140 (GRCm39) C306S probably damaging Het
Frem2 A G 3: 53,493,032 (GRCm39) V1828A probably damaging Het
Gm6457 T C 18: 14,703,174 (GRCm39) noncoding transcript Het
Gmip T G 8: 70,266,785 (GRCm39) V300G probably damaging Het
Gstp3 A G 19: 4,107,607 (GRCm39) S186P probably damaging Het
Gvin-ps3 G C 7: 105,683,181 (GRCm39) noncoding transcript Het
Kl G T 5: 150,912,616 (GRCm39) L788F probably damaging Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Lrp1b A C 2: 41,002,994 (GRCm39) S1932A possibly damaging Het
Lrrc36 A G 8: 106,170,488 (GRCm39) T234A probably damaging Het
Mafa T A 15: 75,618,891 (GRCm39) Q294L possibly damaging Het
Mesp2 C T 7: 79,461,467 (GRCm39) T264I possibly damaging Het
Mindy4 A G 6: 55,201,092 (GRCm39) Y259C probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2d3c A T 7: 106,526,268 (GRCm39) S133T probably benign Het
Or5as1 T C 2: 86,980,825 (GRCm39) Y60C probably damaging Het
Or5m13b A G 2: 85,754,493 (GRCm39) N294D probably damaging Het
Or8b48 A T 9: 38,493,148 (GRCm39) T192S probably damaging Het
Pcm1 T C 8: 41,741,193 (GRCm39) probably null Het
Plxna1 T C 6: 89,297,998 (GRCm39) D1760G probably damaging Het
Polq T A 16: 36,862,540 (GRCm39) D345E probably damaging Het
Ppp1r14a T A 7: 28,988,926 (GRCm39) I56N probably damaging Het
Ppp1r1a G A 15: 103,441,477 (GRCm39) P79S probably damaging Het
Ptprf C T 4: 118,082,305 (GRCm39) R1010H probably benign Het
Rai1 A G 11: 60,081,423 (GRCm39) E1829G probably damaging Het
Rmdn3 A G 2: 118,986,935 (GRCm39) Y31H probably damaging Het
Rrh T C 3: 129,609,280 (GRCm39) S69G probably damaging Het
Skint6 A T 4: 112,752,121 (GRCm39) probably null Het
Slc22a27 C G 19: 7,843,303 (GRCm39) A359P probably damaging Het
Sltm T G 9: 70,486,685 (GRCm39) L450R probably damaging Het
Sufu T C 19: 46,439,404 (GRCm39) probably null Het
Tmem68 T C 4: 3,560,561 (GRCm39) T208A possibly damaging Het
Tnc T A 4: 63,911,534 (GRCm39) R1346* probably null Het
Tpbg T C 9: 85,726,478 (GRCm39) L149P probably damaging Het
Trappc14 C T 5: 138,260,502 (GRCm39) S308N probably benign Het
Ubtf G A 11: 102,198,816 (GRCm39) Q585* probably null Het
Vmn2r68 A T 7: 84,871,085 (GRCm39) C733S probably damaging Het
Vmn2r-ps158 T A 7: 42,672,684 (GRCm39) H106Q probably benign Het
Wscd1 G T 11: 71,659,501 (GRCm39) G194W possibly damaging Het
Zfp354b A C 11: 50,813,917 (GRCm39) I336S probably benign Het
Zfp462 T A 4: 55,016,887 (GRCm39) V870E possibly damaging Het
Other mutations in Bean1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Bean1 APN 8 104,937,550 (GRCm39) missense possibly damaging 0.90
R0135:Bean1 UTSW 8 104,943,807 (GRCm39) missense probably damaging 1.00
R0490:Bean1 UTSW 8 104,941,660 (GRCm39) missense possibly damaging 0.76
R1319:Bean1 UTSW 8 104,943,856 (GRCm39) missense probably benign
R1920:Bean1 UTSW 8 104,937,742 (GRCm39) missense possibly damaging 0.92
R2513:Bean1 UTSW 8 104,908,643 (GRCm39) missense probably benign 0.04
R3980:Bean1 UTSW 8 104,937,730 (GRCm39) missense possibly damaging 0.92
R4209:Bean1 UTSW 8 104,940,566 (GRCm39) start codon destroyed probably null 0.04
R4369:Bean1 UTSW 8 104,943,742 (GRCm39) missense probably damaging 1.00
R4516:Bean1 UTSW 8 104,941,786 (GRCm39) missense probably damaging 1.00
R4542:Bean1 UTSW 8 104,937,591 (GRCm39) missense probably damaging 1.00
R4663:Bean1 UTSW 8 104,937,799 (GRCm39) missense probably damaging 1.00
R4962:Bean1 UTSW 8 104,943,606 (GRCm39) missense probably damaging 1.00
R6288:Bean1 UTSW 8 104,937,622 (GRCm39) missense probably damaging 1.00
R6588:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R6615:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R6994:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7359:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7451:Bean1 UTSW 8 104,940,628 (GRCm39) missense probably benign 0.01
R7454:Bean1 UTSW 8 104,937,658 (GRCm39) missense probably damaging 1.00
R7473:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7537:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7826:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8034:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8418:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8789:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8885:Bean1 UTSW 8 104,908,752 (GRCm39) critical splice donor site probably null
R8888:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8892:Bean1 UTSW 8 104,943,610 (GRCm39) missense probably damaging 1.00
R8896:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8992:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9015:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9113:Bean1 UTSW 8 104,940,557 (GRCm39) missense probably benign 0.00
R9122:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9135:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9151:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9255:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9340:Bean1 UTSW 8 104,908,739 (GRCm39) missense probably damaging 0.99
R9363:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9417:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9537:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9566:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9731:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
RF054:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTCTTGTAAGGGGATGGTCAC -3'
(R):5'- TCATGTCCATCCTCAAGGGG -3'

Sequencing Primer
(F):5'- ACCTCAGATAGATGGCTACTGTGC -3'
(R):5'- GACTTGCTTGGTTGGAGACAGAG -3'
Posted On 2016-07-22