Incidental Mutation 'R5221:Bean1'
ID402325
Institutional Source Beutler Lab
Gene Symbol Bean1
Ensembl Gene ENSMUSG00000031872
Gene Namebrain expressed, associated with Nedd4, 1
Synonyms
MMRRC Submission 042794-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5221 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104170442-104219122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104215152 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 34 (D34V)
Ref Sequence ENSEMBL: ENSMUSP00000148283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]
Predicted Effect probably damaging
Transcript: ENSMUST00000093245
AA Change: D139V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872
AA Change: D139V

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164076
AA Change: D78V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872
AA Change: D78V

DomainStartEndE-ValueType
low complexity region 156 171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167633
AA Change: D139V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872
AA Change: D139V

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171018
AA Change: D210V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872
AA Change: D210V

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 104 124 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212627
Predicted Effect probably damaging
Transcript: ENSMUST00000212979
AA Change: D210V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213077
AA Change: D34V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1381 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap26 T A 18: 39,110,472 Y134* probably null Het
Asap2 A G 12: 21,213,190 I269V probably benign Het
BC037034 C T 5: 138,262,240 S308N probably benign Het
C8a C T 4: 104,845,925 V312M probably damaging Het
Ccser1 T C 6: 61,312,091 S413P probably damaging Het
Col4a2 A G 8: 11,448,225 N1678S probably benign Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Dsg1a T A 18: 20,324,014 M148K possibly damaging Het
Fam173a T C 17: 25,791,639 N67S possibly damaging Het
Farp2 T A 1: 93,576,418 C306S probably damaging Het
Frem2 A G 3: 53,585,611 V1828A probably damaging Het
Gm6457 T C 18: 14,570,117 noncoding transcript Het
Gm8979 G C 7: 106,083,974 noncoding transcript Het
Gm9268 T A 7: 43,023,260 H106Q probably benign Het
Gm9774 T C 3: 92,428,508 I296V probably benign Het
Gmip T G 8: 69,814,135 V300G probably damaging Het
Gstp3 A G 19: 4,057,607 S186P probably damaging Het
Kl G T 5: 150,989,151 L788F probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrp1b A C 2: 41,112,982 S1932A possibly damaging Het
Lrrc36 A G 8: 105,443,856 T234A probably damaging Het
Mafa T A 15: 75,747,042 Q294L possibly damaging Het
Mesp2 C T 7: 79,811,719 T264I possibly damaging Het
Mindy4 A G 6: 55,224,107 Y259C probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1026 A G 2: 85,924,149 N294D probably damaging Het
Olfr1111 T C 2: 87,150,481 Y60C probably damaging Het
Olfr709-ps1 A T 7: 106,927,061 S133T probably benign Het
Olfr912 A T 9: 38,581,852 T192S probably damaging Het
Pcm1 T C 8: 41,288,156 probably null Het
Plxna1 T C 6: 89,321,016 D1760G probably damaging Het
Polq T A 16: 37,042,178 D345E probably damaging Het
Ppp1r14a T A 7: 29,289,501 I56N probably damaging Het
Ppp1r1a G A 15: 103,533,050 P79S probably damaging Het
Ptprf C T 4: 118,225,108 R1010H probably benign Het
Rai1 A G 11: 60,190,597 E1829G probably damaging Het
Rmdn3 A G 2: 119,156,454 Y31H probably damaging Het
Rrh T C 3: 129,815,631 S69G probably damaging Het
Skint6 A T 4: 112,894,924 probably null Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Sltm T G 9: 70,579,403 L450R probably damaging Het
Sufu T C 19: 46,450,965 probably null Het
Tmem68 T C 4: 3,560,561 T208A possibly damaging Het
Tnc T A 4: 63,993,297 R1346* probably null Het
Tpbg T C 9: 85,844,425 L149P probably damaging Het
Ubtf G A 11: 102,307,990 Q585* probably null Het
Vmn2r68 A T 7: 85,221,877 C733S probably damaging Het
Wscd1 G T 11: 71,768,675 G194W possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp462 T A 4: 55,016,887 V870E possibly damaging Het
Other mutations in Bean1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Bean1 APN 8 104210918 missense possibly damaging 0.90
R0135:Bean1 UTSW 8 104217175 missense probably damaging 1.00
R0490:Bean1 UTSW 8 104215028 missense possibly damaging 0.76
R1319:Bean1 UTSW 8 104217224 missense probably benign
R1920:Bean1 UTSW 8 104211110 missense possibly damaging 0.92
R2513:Bean1 UTSW 8 104182011 missense probably benign 0.04
R3980:Bean1 UTSW 8 104211098 missense possibly damaging 0.92
R4209:Bean1 UTSW 8 104213934 start codon destroyed probably null 0.04
R4369:Bean1 UTSW 8 104217110 missense probably damaging 1.00
R4516:Bean1 UTSW 8 104215154 missense probably damaging 1.00
R4542:Bean1 UTSW 8 104210959 missense probably damaging 1.00
R4663:Bean1 UTSW 8 104211167 missense probably damaging 1.00
R4962:Bean1 UTSW 8 104216974 missense probably damaging 1.00
R6288:Bean1 UTSW 8 104210990 missense probably damaging 1.00
R6588:Bean1 UTSW 8 104182032 frame shift probably null
R6615:Bean1 UTSW 8 104182032 frame shift probably null
R6994:Bean1 UTSW 8 104182032 frame shift probably null
R7359:Bean1 UTSW 8 104182032 frame shift probably null
R7451:Bean1 UTSW 8 104213996 missense probably benign 0.01
R7454:Bean1 UTSW 8 104211026 missense probably damaging 1.00
R7473:Bean1 UTSW 8 104182032 frame shift probably null
R7537:Bean1 UTSW 8 104182032 frame shift probably null
R7826:Bean1 UTSW 8 104182032 frame shift probably null
R8034:Bean1 UTSW 8 104182032 frame shift probably null
RF054:Bean1 UTSW 8 104182032 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTCTTGTAAGGGGATGGTCAC -3'
(R):5'- TCATGTCCATCCTCAAGGGG -3'

Sequencing Primer
(F):5'- ACCTCAGATAGATGGCTACTGTGC -3'
(R):5'- GACTTGCTTGGTTGGAGACAGAG -3'
Posted On2016-07-22