Incidental Mutation 'R5221:Sltm'
ID402328
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene NameSAFB-like, transcription modulator
Synonyms9130215G10Rik, 5730555F13Rik, 5730455C01Rik
MMRRC Submission 042794-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5221 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70542754-70592234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70579403 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 450 (L450R)
Ref Sequence ENSEMBL: ENSMUSP00000150324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000213808] [ENSMUST00000216816] [ENSMUST00000217593]
Predicted Effect unknown
Transcript: ENSMUST00000049263
AA Change: L450R
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: L450R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214834
Predicted Effect unknown
Transcript: ENSMUST00000216816
AA Change: L432R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216881
Predicted Effect probably damaging
Transcript: ENSMUST00000217593
AA Change: L450R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9250 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap26 T A 18: 39,110,472 Y134* probably null Het
Asap2 A G 12: 21,213,190 I269V probably benign Het
BC037034 C T 5: 138,262,240 S308N probably benign Het
Bean1 A T 8: 104,215,152 D34V probably damaging Het
C8a C T 4: 104,845,925 V312M probably damaging Het
Ccser1 T C 6: 61,312,091 S413P probably damaging Het
Col4a2 A G 8: 11,448,225 N1678S probably benign Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Dsg1a T A 18: 20,324,014 M148K possibly damaging Het
Fam173a T C 17: 25,791,639 N67S possibly damaging Het
Farp2 T A 1: 93,576,418 C306S probably damaging Het
Frem2 A G 3: 53,585,611 V1828A probably damaging Het
Gm6457 T C 18: 14,570,117 noncoding transcript Het
Gm8979 G C 7: 106,083,974 noncoding transcript Het
Gm9268 T A 7: 43,023,260 H106Q probably benign Het
Gm9774 T C 3: 92,428,508 I296V probably benign Het
Gmip T G 8: 69,814,135 V300G probably damaging Het
Gstp3 A G 19: 4,057,607 S186P probably damaging Het
Kl G T 5: 150,989,151 L788F probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrp1b A C 2: 41,112,982 S1932A possibly damaging Het
Lrrc36 A G 8: 105,443,856 T234A probably damaging Het
Mafa T A 15: 75,747,042 Q294L possibly damaging Het
Mesp2 C T 7: 79,811,719 T264I possibly damaging Het
Mindy4 A G 6: 55,224,107 Y259C probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1026 A G 2: 85,924,149 N294D probably damaging Het
Olfr1111 T C 2: 87,150,481 Y60C probably damaging Het
Olfr709-ps1 A T 7: 106,927,061 S133T probably benign Het
Olfr912 A T 9: 38,581,852 T192S probably damaging Het
Pcm1 T C 8: 41,288,156 probably null Het
Plxna1 T C 6: 89,321,016 D1760G probably damaging Het
Polq T A 16: 37,042,178 D345E probably damaging Het
Ppp1r14a T A 7: 29,289,501 I56N probably damaging Het
Ppp1r1a G A 15: 103,533,050 P79S probably damaging Het
Ptprf C T 4: 118,225,108 R1010H probably benign Het
Rai1 A G 11: 60,190,597 E1829G probably damaging Het
Rmdn3 A G 2: 119,156,454 Y31H probably damaging Het
Rrh T C 3: 129,815,631 S69G probably damaging Het
Skint6 A T 4: 112,894,924 probably null Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Sufu T C 19: 46,450,965 probably null Het
Tmem68 T C 4: 3,560,561 T208A possibly damaging Het
Tnc T A 4: 63,993,297 R1346* probably null Het
Tpbg T C 9: 85,844,425 L149P probably damaging Het
Ubtf G A 11: 102,307,990 Q585* probably null Het
Vmn2r68 A T 7: 85,221,877 C733S probably damaging Het
Wscd1 G T 11: 71,768,675 G194W possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp462 T A 4: 55,016,887 V870E possibly damaging Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R3410:Sltm UTSW 9 70585958 missense probably damaging 0.97
R4323:Sltm UTSW 9 70580247 missense probably benign
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6297:Sltm UTSW 9 70581359 missense probably damaging 0.99
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7631:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7888:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7889:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7891:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8099:Sltm UTSW 9 70586078 missense probably damaging 1.00
R8374:Sltm UTSW 9 70561945 missense probably null
R8698:Sltm UTSW 9 70587070 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGAGCGGACAGAATGATTCCC -3'
(R):5'- GTTGAGCATCCTAACCAAGAAC -3'

Sequencing Primer
(F):5'- CGGACAGAATGATTCCCATAGTG -3'
(R):5'- GCATCCTAACCAAGAACTCTGAAATG -3'
Posted On2016-07-22