Mutagenetix > Incidental Mutation

Incidental Mutation 'R5222:Col19a1'

402346

Institutional Source

Beutler Lab

Gene Symbol

Col19a1

Ensembl Gene

ENSMUSG00000026141

Gene Name

collagen, type XIX, alpha 1

Synonyms

MMRRC Submission

042795-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5222 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24261890-24587472 bp(-) (GRCm38)

Type of Mutation

splice site (14 bp from exon)

DNA Base Change (assembly)

A to C at 24559640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051344] [ENSMUST00000115244]

AlphaFold

Q0VF58

Predicted Effect

probably null
Transcript: ENSMUST00000051344

SMART Domains

Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TSPN	47	231	1.61e-63	SMART
low complexity region	254	266	N/A	INTRINSIC
Pfam:Collagen	288	349	1e-9	PFAM
Pfam:Collagen	325	391	2.2e-10	PFAM
Pfam:Collagen	376	442	1.4e-8	PFAM
Pfam:Collagen	436	500	2.9e-9	PFAM
Pfam:Collagen	474	536	6.3e-10	PFAM
Pfam:Collagen	519	579	5.6e-10	PFAM
Pfam:Collagen	559	620	1.2e-8	PFAM
Pfam:Collagen	619	675	8.7e-11	PFAM
Pfam:Collagen	697	774	2.4e-8	PFAM
Pfam:Collagen	753	819	8.7e-10	PFAM
Pfam:Collagen	831	892	8.8e-12	PFAM
internal_repeat_2	905	943	3.52e-11	PROSPERO
internal_repeat_1	905	980	8.61e-26	PROSPERO
internal_repeat_2	947	982	3.52e-11	PROSPERO
low complexity region	983	1003	N/A	INTRINSIC
low complexity region	1030	1042	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115244

SMART Domains

Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TSPN	47	231	1.61e-63	SMART
low complexity region	254	266	N/A	INTRINSIC
Pfam:Collagen	288	347	3.1e-9	PFAM
Pfam:Collagen	330	391	1.1e-9	PFAM
internal_repeat_4	455	492	1.88e-5	PROSPERO
Pfam:Collagen	519	579	2e-9	PFAM
Pfam:Collagen	559	620	4.9e-8	PFAM
Pfam:Collagen	619	675	3.5e-10	PFAM
low complexity region	723	741	N/A	INTRINSIC
Pfam:Collagen	753	819	2.8e-9	PFAM
Pfam:Collagen	831	892	3.9e-11	PFAM
internal_repeat_2	905	943	1.18e-11	PROSPERO
internal_repeat_1	905	980	8.89e-27	PROSPERO
internal_repeat_2	947	982	1.18e-11	PROSPERO
low complexity region	983	1003	N/A	INTRINSIC
low complexity region	1048	1069	N/A	INTRINSIC
low complexity region	1078	1115	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	C	A	1: 160,044,608		noncoding transcript	Het
Acad11	G	A	9: 104,097,377	A515T	probably damaging	Het
Angpt1	T	C	15: 42,676,334	Y43C	probably damaging	Het
Arhgef33	A	G	17: 80,337,314	Y24C	probably damaging	Het
Cd40	G	C	2: 165,066,544	S180T	probably benign	Het
Cenpc1	A	T	5: 86,037,747	S302T	possibly damaging	Het
Cit	C	A	5: 115,952,543	T932K	probably benign	Het
Dapk3	A	G	10: 81,192,460	E288G	probably damaging	Het
Ddx60	T	C	8: 61,984,158	F1002S	probably damaging	Het
Dgke	G	T	11: 89,050,394	T321K	probably benign	Het
Ebf2	T	G	14: 67,313,594		probably benign	Het
Enpp7	A	G	11: 118,990,962	D311G	probably benign	Het
Epm2a	A	G	10: 11,448,749	E194G	probably damaging	Het
Esf1	A	G	2: 140,158,583	Y428H	possibly damaging	Het
Esyt2	T	C	12: 116,318,826	F132S	probably damaging	Het
Gm13101	T	A	4: 143,964,792	I454F	possibly damaging	Het
Gm5455	T	C	13: 110,304,960		noncoding transcript	Het
Gria1	T	A	11: 57,189,797	V202E	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Mark1	A	T	1: 184,928,091	F123I	probably damaging	Het
Nectin4	T	A	1: 171,385,257		probably null	Het
Obscn	T	A	11: 59,044,145	T5220S	possibly damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1370	T	A	13: 21,072,569	H244L	probably damaging	Het
Olfr166	A	C	16: 19,486,930	I31L	probably benign	Het
Pdcd1	A	T	1: 94,052,450	V14E	probably damaging	Het
Pmel	A	G	10: 128,718,984		probably null	Het
Prrx1	C	T	1: 163,261,973	R95Q	probably damaging	Het
Pstpip2	T	A	18: 77,874,332	Y267*	probably null	Het
Ptprq	A	G	10: 107,662,564	I884T	probably damaging	Het
Rad17	G	A	13: 100,633,891	T216I	possibly damaging	Het
Rif1	T	C	2: 52,077,020	I107T	probably benign	Het
Rpp14	T	C	14: 8,087,513	L69P	probably damaging	Het
Rtel1	G	T	2: 181,346,983		probably benign	Het
Sap130	C	T	18: 31,666,703	T362M	probably damaging	Het
Scn11a	A	G	9: 119,815,202		probably null	Het
Sec31a	G	T	5: 100,382,895	T243N	probably benign	Het
Slc5a9	T	A	4: 111,898,611	H30L	possibly damaging	Het
Slco6b1	T	A	1: 96,997,491		noncoding transcript	Het
Smarca4	A	G	9: 21,655,706	D694G	probably benign	Het
Spaca6	A	G	17: 17,838,105	T213A	probably benign	Het
Tagap	C	A	17: 7,933,641	Q553K	possibly damaging	Het
Tagap	A	T	17: 7,933,642	Q553L	possibly damaging	Het
Tcf7l2	A	G	19: 55,898,612	Q19R	probably benign	Het
Ttn	A	G	2: 76,878,853		probably benign	Het
Ubr7	A	T	12: 102,775,705	R399S	probably benign	Het
Uspl1	C	A	5: 149,214,101	Q690K	possibly damaging	Het
Vps8	T	A	16: 21,581,548	Y853*	probably null	Het
Vrk3	A	T	7: 44,759,796	Q129L	possibly damaging	Het
Wapl	T	A	14: 34,736,685	C901*	probably null	Het

Other mutations in Col19a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Col19a1	APN	1	24561306	missense	unknown
IGL00514:Col19a1	APN	1	24536932	missense	unknown
IGL00756:Col19a1	APN	1	24322942	missense	possibly damaging	0.85
IGL01408:Col19a1	APN	1	24306250	splice site	probably benign
IGL01608:Col19a1	APN	1	24282545	missense	probably damaging	1.00
IGL01664:Col19a1	APN	1	24561335	missense	unknown
IGL01906:Col19a1	APN	1	24317429	missense	probably damaging	1.00
IGL01916:Col19a1	APN	1	24534241	missense	unknown
IGL02040:Col19a1	APN	1	24312045	critical splice donor site	probably null
IGL02407:Col19a1	APN	1	24312372	splice site	probably null
IGL02505:Col19a1	APN	1	24300584	splice site	probably benign
IGL02606:Col19a1	APN	1	24534116	nonsense	probably null
IGL02659:Col19a1	APN	1	24534034	missense	unknown
IGL02815:Col19a1	APN	1	24285251	splice site	probably null
IGL02880:Col19a1	APN	1	24325973	splice site	probably benign
IGL02897:Col19a1	APN	1	24534098	missense	unknown
IGL03102:Col19a1	APN	1	24328053	missense	probably damaging	1.00
R0038:Col19a1	UTSW	1	24559744	missense	unknown
R0109:Col19a1	UTSW	1	24559768	splice site	probably null
R0124:Col19a1	UTSW	1	24526458	missense	unknown
R0326:Col19a1	UTSW	1	24285051	critical splice donor site	probably null
R0390:Col19a1	UTSW	1	24289655	splice site	probably benign
R0675:Col19a1	UTSW	1	24575455	start gained	probably benign
R0826:Col19a1	UTSW	1	24526386	missense	unknown
R0948:Col19a1	UTSW	1	24296801	missense	probably damaging	0.98
R1014:Col19a1	UTSW	1	24301273	critical splice donor site	probably null
R1619:Col19a1	UTSW	1	24534091	missense	unknown
R1691:Col19a1	UTSW	1	24536941	missense	unknown
R1878:Col19a1	UTSW	1	24317395	missense	probably benign	0.40
R1901:Col19a1	UTSW	1	24536997	missense	unknown
R1928:Col19a1	UTSW	1	24451754	splice site	probably benign
R1940:Col19a1	UTSW	1	24264750	nonsense	probably null
R2015:Col19a1	UTSW	1	24559753	missense	unknown
R2571:Col19a1	UTSW	1	24374631	missense	unknown
R2844:Col19a1	UTSW	1	24559681	missense	unknown
R2845:Col19a1	UTSW	1	24559681	missense	unknown
R3107:Col19a1	UTSW	1	24337936	missense	possibly damaging	0.71
R3861:Col19a1	UTSW	1	24326017	missense	probably damaging	1.00
R3872:Col19a1	UTSW	1	24575327	splice site	probably benign
R4180:Col19a1	UTSW	1	24270392	missense	probably damaging	1.00
R4195:Col19a1	UTSW	1	24534052	missense	unknown
R4196:Col19a1	UTSW	1	24534052	missense	unknown
R4234:Col19a1	UTSW	1	24315395	splice site	probably null
R4250:Col19a1	UTSW	1	24525645	missense	unknown
R4396:Col19a1	UTSW	1	24510866	missense	unknown
R4405:Col19a1	UTSW	1	24534109	missense	unknown
R4450:Col19a1	UTSW	1	24322035	missense	probably damaging	0.96
R4583:Col19a1	UTSW	1	24561329	missense	unknown
R4980:Col19a1	UTSW	1	24526483	missense	unknown
R5407:Col19a1	UTSW	1	24303494	missense	probably damaging	0.99
R5439:Col19a1	UTSW	1	24293112	missense	probably damaging	1.00
R5739:Col19a1	UTSW	1	24337915	missense	probably damaging	1.00
R5740:Col19a1	UTSW	1	24337915	missense	probably damaging	1.00
R5891:Col19a1	UTSW	1	24289725	missense	probably damaging	1.00
R5996:Col19a1	UTSW	1	24328071	missense	probably damaging	1.00
R6074:Col19a1	UTSW	1	24526483	missense	unknown
R6152:Col19a1	UTSW	1	24374621	missense	unknown
R6191:Col19a1	UTSW	1	24317393	missense	probably damaging	1.00
R6236:Col19a1	UTSW	1	24279949	missense	probably damaging	1.00
R6315:Col19a1	UTSW	1	24526452	missense	unknown
R6709:Col19a1	UTSW	1	24282496	missense	probably damaging	1.00
R6748:Col19a1	UTSW	1	24534070	missense	unknown
R7098:Col19a1	UTSW	1	24526474	missense	unknown
R7114:Col19a1	UTSW	1	24337936	missense	possibly damaging	0.71
R7292:Col19a1	UTSW	1	24530008	missense	unknown
R7392:Col19a1	UTSW	1	24534034	missense	unknown
R7478:Col19a1	UTSW	1	24317707	missense	probably damaging	1.00
R7480:Col19a1	UTSW	1	24317707	missense	probably damaging	1.00
R7481:Col19a1	UTSW	1	24317707	missense	probably damaging	1.00
R7512:Col19a1	UTSW	1	24317707	missense	probably damaging	1.00
R7618:Col19a1	UTSW	1	24322084	missense	probably benign	0.07
R7698:Col19a1	UTSW	1	24312078	missense	probably benign	0.09
R7711:Col19a1	UTSW	1	24530008	missense	unknown
R7725:Col19a1	UTSW	1	24270444	missense	possibly damaging	0.94
R7831:Col19a1	UTSW	1	24526482	missense	unknown
R8252:Col19a1	UTSW	1	24279967	missense	probably benign	0.05
R8728:Col19a1	UTSW	1	24326032	missense	probably damaging	1.00
R9057:Col19a1	UTSW	1	24510881	missense	unknown
R9210:Col19a1	UTSW	1	24461474	critical splice donor site	probably null
R9212:Col19a1	UTSW	1	24461474	critical splice donor site	probably null
R9712:Col19a1	UTSW	1	24328067	missense	possibly damaging	0.86
R9777:Col19a1	UTSW	1	24279823	missense	unknown
Z1088:Col19a1	UTSW	1	24279940	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTCTGAATCTACATTGAGCCTTATG -3'
(R):5'- CAACCTGTGGATATGGATAACAAAG -3'

Sequencing Primer
(F):5'- GTTAAATGTCAATTAGGTTTCTCCCC -3'
(R):5'- CTGTGGATATGGATAACAAAGAATCC -3'

Posted On

2016-07-22