Incidental Mutation 'R5222:Col19a1'
ID402346
Institutional Source Beutler Lab
Gene Symbol Col19a1
Ensembl Gene ENSMUSG00000026141
Gene Namecollagen, type XIX, alpha 1
Synonyms
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location24261890-24587472 bp(-) (GRCm38)
Type of Mutationsplice site (14 bp from exon)
DNA Base Change (assembly) A to C at 24559640 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051344] [ENSMUST00000115244]
Predicted Effect probably null
Transcript: ENSMUST00000051344
SMART Domains Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 349 1e-9 PFAM
Pfam:Collagen 325 391 2.2e-10 PFAM
Pfam:Collagen 376 442 1.4e-8 PFAM
Pfam:Collagen 436 500 2.9e-9 PFAM
Pfam:Collagen 474 536 6.3e-10 PFAM
Pfam:Collagen 519 579 5.6e-10 PFAM
Pfam:Collagen 559 620 1.2e-8 PFAM
Pfam:Collagen 619 675 8.7e-11 PFAM
Pfam:Collagen 697 774 2.4e-8 PFAM
Pfam:Collagen 753 819 8.7e-10 PFAM
Pfam:Collagen 831 892 8.8e-12 PFAM
internal_repeat_2 905 943 3.52e-11 PROSPERO
internal_repeat_1 905 980 8.61e-26 PROSPERO
internal_repeat_2 947 982 3.52e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115244
SMART Domains Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 347 3.1e-9 PFAM
Pfam:Collagen 330 391 1.1e-9 PFAM
internal_repeat_4 455 492 1.88e-5 PROSPERO
Pfam:Collagen 519 579 2e-9 PFAM
Pfam:Collagen 559 620 4.9e-8 PFAM
Pfam:Collagen 619 675 3.5e-10 PFAM
low complexity region 723 741 N/A INTRINSIC
Pfam:Collagen 753 819 2.8e-9 PFAM
Pfam:Collagen 831 892 3.9e-11 PFAM
internal_repeat_2 905 943 1.18e-11 PROSPERO
internal_repeat_1 905 980 8.89e-27 PROSPERO
internal_repeat_2 947 982 1.18e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1048 1069 N/A INTRINSIC
low complexity region 1078 1115 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Col19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col19a1 APN 1 24561306 missense unknown
IGL00514:Col19a1 APN 1 24536932 missense unknown
IGL00756:Col19a1 APN 1 24322942 missense possibly damaging 0.85
IGL01408:Col19a1 APN 1 24306250 splice site probably benign
IGL01608:Col19a1 APN 1 24282545 missense probably damaging 1.00
IGL01664:Col19a1 APN 1 24561335 missense unknown
IGL01906:Col19a1 APN 1 24317429 missense probably damaging 1.00
IGL01916:Col19a1 APN 1 24534241 missense unknown
IGL02040:Col19a1 APN 1 24312045 critical splice donor site probably null
IGL02407:Col19a1 APN 1 24312372 splice site probably null
IGL02505:Col19a1 APN 1 24300584 splice site probably benign
IGL02606:Col19a1 APN 1 24534116 nonsense probably null
IGL02659:Col19a1 APN 1 24534034 missense unknown
IGL02815:Col19a1 APN 1 24285251 splice site probably null
IGL02880:Col19a1 APN 1 24325973 splice site probably benign
IGL02897:Col19a1 APN 1 24534098 missense unknown
IGL03102:Col19a1 APN 1 24328053 missense probably damaging 1.00
R0038:Col19a1 UTSW 1 24559744 missense unknown
R0109:Col19a1 UTSW 1 24559768 splice site probably null
R0124:Col19a1 UTSW 1 24526458 missense unknown
R0326:Col19a1 UTSW 1 24285051 critical splice donor site probably null
R0390:Col19a1 UTSW 1 24289655 splice site probably benign
R0675:Col19a1 UTSW 1 24575455 start gained probably benign
R0826:Col19a1 UTSW 1 24526386 missense unknown
R0948:Col19a1 UTSW 1 24296801 missense probably damaging 0.98
R1014:Col19a1 UTSW 1 24301273 critical splice donor site probably null
R1619:Col19a1 UTSW 1 24534091 missense unknown
R1691:Col19a1 UTSW 1 24536941 missense unknown
R1878:Col19a1 UTSW 1 24317395 missense probably benign 0.40
R1901:Col19a1 UTSW 1 24536997 missense unknown
R1928:Col19a1 UTSW 1 24451754 splice site probably benign
R1940:Col19a1 UTSW 1 24264750 nonsense probably null
R2015:Col19a1 UTSW 1 24559753 missense unknown
R2571:Col19a1 UTSW 1 24374631 missense unknown
R2844:Col19a1 UTSW 1 24559681 missense unknown
R2845:Col19a1 UTSW 1 24559681 missense unknown
R3107:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R3861:Col19a1 UTSW 1 24326017 missense probably damaging 1.00
R3872:Col19a1 UTSW 1 24575327 splice site probably benign
R4180:Col19a1 UTSW 1 24270392 missense probably damaging 1.00
R4195:Col19a1 UTSW 1 24534052 missense unknown
R4196:Col19a1 UTSW 1 24534052 missense unknown
R4234:Col19a1 UTSW 1 24315395 splice site probably null
R4250:Col19a1 UTSW 1 24525645 missense unknown
R4396:Col19a1 UTSW 1 24510866 missense unknown
R4405:Col19a1 UTSW 1 24534109 missense unknown
R4450:Col19a1 UTSW 1 24322035 missense probably damaging 0.96
R4583:Col19a1 UTSW 1 24561329 missense unknown
R4980:Col19a1 UTSW 1 24526483 missense unknown
R5407:Col19a1 UTSW 1 24303494 missense probably damaging 0.99
R5439:Col19a1 UTSW 1 24293112 missense probably damaging 1.00
R5739:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5740:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5891:Col19a1 UTSW 1 24289725 missense probably damaging 1.00
R5996:Col19a1 UTSW 1 24328071 missense probably damaging 1.00
R6074:Col19a1 UTSW 1 24526483 missense unknown
R6152:Col19a1 UTSW 1 24374621 missense unknown
R6191:Col19a1 UTSW 1 24317393 missense probably damaging 1.00
R6236:Col19a1 UTSW 1 24279949 missense probably damaging 1.00
R6315:Col19a1 UTSW 1 24526452 missense unknown
R6709:Col19a1 UTSW 1 24282496 missense probably damaging 1.00
R6748:Col19a1 UTSW 1 24534070 missense unknown
R7098:Col19a1 UTSW 1 24526474 missense unknown
R7114:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R7292:Col19a1 UTSW 1 24530008 missense unknown
R7392:Col19a1 UTSW 1 24534034 missense unknown
R7478:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7480:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7481:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7512:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7618:Col19a1 UTSW 1 24322084 missense probably benign 0.07
R7698:Col19a1 UTSW 1 24312078 missense probably benign 0.09
R7711:Col19a1 UTSW 1 24530008 missense unknown
R7725:Col19a1 UTSW 1 24270444 missense possibly damaging 0.94
R7831:Col19a1 UTSW 1 24526482 missense unknown
R7914:Col19a1 UTSW 1 24526482 missense unknown
R8252:Col19a1 UTSW 1 24279967 missense probably benign 0.05
Z1088:Col19a1 UTSW 1 24279940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCTGAATCTACATTGAGCCTTATG -3'
(R):5'- CAACCTGTGGATATGGATAACAAAG -3'

Sequencing Primer
(F):5'- GTTAAATGTCAATTAGGTTTCTCCCC -3'
(R):5'- CTGTGGATATGGATAACAAAGAATCC -3'
Posted On2016-07-22