Incidental Mutation 'R5222:Pdcd1'
List |< first << previous [record 27 of 51] next >> last >|
ID402347
Institutional Source Beutler Lab
Gene Symbol Pdcd1
Ensembl Gene ENSMUSG00000026285
Gene Nameprogrammed cell death 1
SynonymsPD-1, Pdc1
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location94038305-94052553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94052450 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 14 (V14E)
Ref Sequence ENSEMBL: ENSMUSP00000027507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027507]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MURINE PD-1 [X-RAY DIFFRACTION]
Crystal Structure of the PD-1/PD-L1 Complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 Mutant and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the complex between mouse PD-1 mutant and PD-L2 IgV domain [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and PD-L2 [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and human PD-L1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027507
AA Change: V14E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027507
Gene: ENSMUSG00000026285
AA Change: V14E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 39 145 3.33e-9 SMART
transmembrane domain 170 192 N/A INTRINSIC
Meta Mutation Damage Score 0.3783 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface membrane protein of the immunoglobulin superfamily. This protein is expressed in pro-B-cells and is thought to play a role in their differentiation. In mice, expression of this gene is induced in the thymus when anti-CD3 antibodies are injected and large numbers of thymocytes undergo apoptosis. Mice deficient for this gene bred on a BALB/c background developed dilated cardiomyopathy and died from congestive heart failure. These studies suggest that this gene product may also be important in T cell function and contribute to the prevention of autoimmune diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in leukopoiesis and the immune system which vary considerably depending on the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Pdcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Pdcd1 APN 1 94040135 splice site probably benign
IGL01522:Pdcd1 APN 1 94040846 missense probably benign 0.00
IGL02337:Pdcd1 APN 1 94040857 missense probably benign 0.08
IGL02750:Pdcd1 APN 1 94039544 splice site probably benign
R6720_Pdcd1_520 UTSW 1 94041389 missense probably benign 0.00
R0092:Pdcd1 UTSW 1 94052424 missense possibly damaging 0.49
R0554:Pdcd1 UTSW 1 94039382 missense probably damaging 1.00
R0931:Pdcd1 UTSW 1 94039513 missense probably benign 0.05
R3932:Pdcd1 UTSW 1 94041264 missense probably benign 0.01
R5914:Pdcd1 UTSW 1 94040825 missense probably benign 0.15
R6186:Pdcd1 UTSW 1 94040121 nonsense probably null
R6720:Pdcd1 UTSW 1 94041389 missense probably benign 0.00
R6844:Pdcd1 UTSW 1 94039381 missense probably benign 0.36
R7966:Pdcd1 UTSW 1 94041461 missense probably damaging 1.00
R8233:Pdcd1 UTSW 1 94039417 missense probably damaging 1.00
R8387:Pdcd1 UTSW 1 94041468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCTGTCTAAAAGCAAGGAGGG -3'
(R):5'- AAGAACAGGTCTCCTCCCTC -3'

Sequencing Primer
(F):5'- GGGGGCATTTCACCTGTAAAACC -3'
(R):5'- TCCCTCCAACATGACCTGGG -3'
Posted On2016-07-22