Incidental Mutation 'R5222:Nectin4'
List |< first << previous [record 22 of 51] next >> last >|
ID402351
Institutional Source Beutler Lab
Gene Symbol Nectin4
Ensembl Gene ENSMUSG00000006411
Gene Namenectin cell adhesion molecule 4
Synonyms1200017F15Rik, Prr4, Pvrl4, nectin 4
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171370099-171388598 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 171385257 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006578] [ENSMUST00000056449] [ENSMUST00000094325] [ENSMUST00000111286]
Predicted Effect probably null
Transcript: ENSMUST00000006578
SMART Domains Protein: ENSMUSP00000006578
Gene: ENSMUSG00000006411

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 4e-4 PFAM
Pfam:C2-set_2 150 233 9e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056449
SMART Domains Protein: ENSMUSP00000059389
Gene: ENSMUSG00000048865

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
RhoGAP 31 212 1.4e-61 SMART
Blast:RhoGAP 225 285 2e-24 BLAST
low complexity region 348 366 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
low complexity region 498 510 N/A INTRINSIC
low complexity region 514 534 N/A INTRINSIC
low complexity region 667 690 N/A INTRINSIC
low complexity region 736 752 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000094325
SMART Domains Protein: ENSMUSP00000091883
Gene: ENSMUSG00000006411

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 2.1e-4 PFAM
Pfam:C2-set_2 150 233 8.7e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111286
SMART Domains Protein: ENSMUSP00000106917
Gene: ENSMUSG00000006411

DomainStartEndE-ValueType
IG 100 209 9.26e-8 SMART
Pfam:C2-set_2 214 297 1.2e-16 PFAM
IGc2 323 385 9.78e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194914
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family. The encoded protein contains two immunoglobulin-like (Ig-like) C2-type domains and one Ig-like V-type domain. It is involved in cell adhesion through trans-homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. The soluble form is produced by proteolytic cleavage at the cell surface by the metalloproteinase ADAM17/TACE. The secreted form is found in both breast tumor cell lines and breast tumor patients. Mutations in this gene are the cause of ectodermal dysplasia-syndactyly syndrome type 1, an autosomal recessive disorder. Alternatively spliced transcript variants have been found but the full-length nature of the variant has not been determined.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Nectin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Nectin4 APN 1 171384686 missense probably damaging 1.00
IGL01558:Nectin4 APN 1 171384689 missense probably benign 0.00
IGL02608:Nectin4 APN 1 171384773 missense probably benign 0.05
R2047:Nectin4 UTSW 1 171385152 missense possibly damaging 0.61
R2203:Nectin4 UTSW 1 171386229 missense possibly damaging 0.78
R2518:Nectin4 UTSW 1 171380208 missense probably benign 0.00
R4125:Nectin4 UTSW 1 171385733 missense probably benign 0.02
R4708:Nectin4 UTSW 1 171385146 missense probably benign 0.02
R4856:Nectin4 UTSW 1 171384815 missense possibly damaging 0.46
R4886:Nectin4 UTSW 1 171384815 missense possibly damaging 0.46
R5264:Nectin4 UTSW 1 171383705 missense probably benign 0.00
R5661:Nectin4 UTSW 1 171385170 missense probably damaging 1.00
R6466:Nectin4 UTSW 1 171386753 missense probably damaging 1.00
R6714:Nectin4 UTSW 1 171370650 start gained probably benign
R7272:Nectin4 UTSW 1 171386644 missense probably damaging 1.00
R7302:Nectin4 UTSW 1 171386635 nonsense probably null
R7318:Nectin4 UTSW 1 171380463 missense probably benign 0.16
R7669:Nectin4 UTSW 1 171380259 missense probably benign 0.00
R7732:Nectin4 UTSW 1 171386678 missense probably benign 0.00
R7751:Nectin4 UTSW 1 171383758 critical splice donor site probably null
R7912:Nectin4 UTSW 1 171380373 missense possibly damaging 0.86
R7993:Nectin4 UTSW 1 171383754 missense probably damaging 1.00
R8029:Nectin4 UTSW 1 171386687 missense probably benign 0.04
R8306:Nectin4 UTSW 1 171383757 missense probably null 1.00
R8314:Nectin4 UTSW 1 171384727 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ATCTCAGACACTGGCCTGTC -3'
(R):5'- AGCGCTAAAGTGTGCATGG -3'

Sequencing Primer
(F):5'- GACACTGGCCTGTCTCCAAC -3'
(R):5'- GATCTGTGCTTCTCTTAGGCAGAC -3'
Posted On2016-07-22