Incidental Mutation 'R5222:Mark1'
ID 402353
Institutional Source Beutler Lab
Gene Symbol Mark1
Ensembl Gene ENSMUSG00000026620
Gene Name MAP/microtubule affinity regulating kinase 1
Synonyms Emk3, B930025N23Rik
MMRRC Submission 042795-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.351) question?
Stock # R5222 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 184628986-184731767 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 184660288 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 123 (F123I)
Ref Sequence ENSEMBL: ENSMUSP00000027929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027929] [ENSMUST00000192657]
AlphaFold Q8VHJ5
Predicted Effect probably damaging
Transcript: ENSMUST00000027929
AA Change: F123I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027929
Gene: ENSMUSG00000026620
AA Change: F123I

DomainStartEndE-ValueType
S_TKc 60 311 1.12e-108 SMART
low complexity region 316 328 N/A INTRINSIC
UBA 332 369 4.56e-9 SMART
low complexity region 376 386 N/A INTRINSIC
low complexity region 523 547 N/A INTRINSIC
low complexity region 585 599 N/A INTRINSIC
Pfam:KA1 751 795 4.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192657
AA Change: F13I

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142314
Gene: ENSMUSG00000026620
AA Change: F13I

DomainStartEndE-ValueType
S_TKc 1 152 3.8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192968
Meta Mutation Damage Score 0.5396 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 159,872,178 (GRCm39) noncoding transcript Het
Acad11 G A 9: 103,974,576 (GRCm39) A515T probably damaging Het
Angpt1 T C 15: 42,539,730 (GRCm39) Y43C probably damaging Het
Arhgef33 A G 17: 80,644,743 (GRCm39) Y24C probably damaging Het
Cd40 G C 2: 164,908,464 (GRCm39) S180T probably benign Het
Cenpc1 A T 5: 86,185,606 (GRCm39) S302T possibly damaging Het
Cit C A 5: 116,090,602 (GRCm39) T932K probably benign Het
Col19a1 A C 1: 24,598,721 (GRCm39) probably null Het
Dapk3 A G 10: 81,028,294 (GRCm39) E288G probably damaging Het
Ddx60 T C 8: 62,437,192 (GRCm39) F1002S probably damaging Het
Dgke G T 11: 88,941,220 (GRCm39) T321K probably benign Het
Ebf2 T G 14: 67,551,043 (GRCm39) probably benign Het
Enpp7 A G 11: 118,881,788 (GRCm39) D311G probably benign Het
Epm2a A G 10: 11,324,493 (GRCm39) E194G probably damaging Het
Esf1 A G 2: 140,000,503 (GRCm39) Y428H possibly damaging Het
Esyt2 T C 12: 116,282,446 (GRCm39) F132S probably damaging Het
Gm5455 T C 13: 110,441,494 (GRCm39) noncoding transcript Het
Gria1 T A 11: 57,080,623 (GRCm39) V202E probably benign Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Nectin4 T A 1: 171,212,825 (GRCm39) probably null Het
Obscn T A 11: 58,934,971 (GRCm39) T5220S possibly damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2l13 A C 16: 19,305,680 (GRCm39) I31L probably benign Het
Or2p2 T A 13: 21,256,739 (GRCm39) H244L probably damaging Het
Pdcd1 A T 1: 93,980,175 (GRCm39) V14E probably damaging Het
Pmel A G 10: 128,554,853 (GRCm39) probably null Het
Pramel28 T A 4: 143,691,362 (GRCm39) I454F possibly damaging Het
Prrx1 C T 1: 163,089,542 (GRCm39) R95Q probably damaging Het
Pstpip2 T A 18: 77,962,032 (GRCm39) Y267* probably null Het
Ptprq A G 10: 107,498,425 (GRCm39) I884T probably damaging Het
Rad17 G A 13: 100,770,399 (GRCm39) T216I possibly damaging Het
Rif1 T C 2: 51,967,032 (GRCm39) I107T probably benign Het
Rpp14 T C 14: 8,087,513 (GRCm38) L69P probably damaging Het
Rtel1 G T 2: 180,988,776 (GRCm39) probably benign Het
Sap130 C T 18: 31,799,756 (GRCm39) T362M probably damaging Het
Scn11a A G 9: 119,644,268 (GRCm39) probably null Het
Sec31a G T 5: 100,530,754 (GRCm39) T243N probably benign Het
Slc5a9 T A 4: 111,755,808 (GRCm39) H30L possibly damaging Het
Slco6b1 T A 1: 96,925,216 (GRCm39) noncoding transcript Het
Smarca4 A G 9: 21,567,002 (GRCm39) D694G probably benign Het
Spaca6 A G 17: 18,058,367 (GRCm39) T213A probably benign Het
Tagap C A 17: 8,152,473 (GRCm39) Q553K possibly damaging Het
Tagap A T 17: 8,152,474 (GRCm39) Q553L possibly damaging Het
Tcf7l2 A G 19: 55,887,044 (GRCm39) Q19R probably benign Het
Ttn A G 2: 76,709,197 (GRCm39) probably benign Het
Ubr7 A T 12: 102,741,964 (GRCm39) R399S probably benign Het
Uspl1 C A 5: 149,150,911 (GRCm39) Q690K possibly damaging Het
Vps8 T A 16: 21,400,298 (GRCm39) Y853* probably null Het
Vrk3 A T 7: 44,409,220 (GRCm39) Q129L possibly damaging Het
Wapl T A 14: 34,458,642 (GRCm39) C901* probably null Het
Other mutations in Mark1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mark1 APN 1 184,630,800 (GRCm39) missense probably damaging 1.00
IGL00674:Mark1 APN 1 184,644,303 (GRCm39) missense probably benign
IGL01903:Mark1 APN 1 184,661,577 (GRCm39) splice site probably benign
IGL02004:Mark1 APN 1 184,644,786 (GRCm39) missense possibly damaging 0.82
IGL03177:Mark1 APN 1 184,677,104 (GRCm39) missense probably damaging 1.00
IGL03189:Mark1 APN 1 184,651,890 (GRCm39) missense probably damaging 0.96
IGL03391:Mark1 APN 1 184,651,632 (GRCm39) unclassified probably benign
R0277:Mark1 UTSW 1 184,677,149 (GRCm39) missense possibly damaging 0.89
R0744:Mark1 UTSW 1 184,653,805 (GRCm39) missense probably damaging 1.00
R0973:Mark1 UTSW 1 184,653,801 (GRCm39) missense probably damaging 1.00
R1331:Mark1 UTSW 1 184,660,245 (GRCm39) missense probably damaging 1.00
R2061:Mark1 UTSW 1 184,660,260 (GRCm39) missense probably damaging 1.00
R2136:Mark1 UTSW 1 184,651,770 (GRCm39) missense probably damaging 1.00
R2306:Mark1 UTSW 1 184,633,058 (GRCm39) splice site probably benign
R3159:Mark1 UTSW 1 184,640,584 (GRCm39) missense probably damaging 1.00
R3905:Mark1 UTSW 1 184,640,632 (GRCm39) splice site probably null
R4321:Mark1 UTSW 1 184,630,871 (GRCm39) missense possibly damaging 0.46
R4512:Mark1 UTSW 1 184,639,286 (GRCm39) missense probably benign 0.21
R4715:Mark1 UTSW 1 184,644,329 (GRCm39) missense probably benign 0.00
R4829:Mark1 UTSW 1 184,637,724 (GRCm39) missense possibly damaging 0.82
R5163:Mark1 UTSW 1 184,637,807 (GRCm39) missense probably damaging 0.98
R5680:Mark1 UTSW 1 184,677,013 (GRCm39) missense probably damaging 1.00
R6582:Mark1 UTSW 1 184,644,786 (GRCm39) missense possibly damaging 0.82
R6943:Mark1 UTSW 1 184,630,984 (GRCm39) missense probably damaging 1.00
R6979:Mark1 UTSW 1 184,644,825 (GRCm39) missense possibly damaging 0.77
R7031:Mark1 UTSW 1 184,644,829 (GRCm39) missense possibly damaging 0.82
R7455:Mark1 UTSW 1 184,651,947 (GRCm39) missense probably damaging 0.99
R7470:Mark1 UTSW 1 184,660,241 (GRCm39) nonsense probably null
R7715:Mark1 UTSW 1 184,639,431 (GRCm39) missense probably damaging 0.98
R8193:Mark1 UTSW 1 184,660,249 (GRCm39) missense probably damaging 0.99
R8474:Mark1 UTSW 1 184,651,783 (GRCm39) missense probably damaging 1.00
R9114:Mark1 UTSW 1 184,644,261 (GRCm39) missense probably damaging 0.99
R9336:Mark1 UTSW 1 184,648,345 (GRCm39) missense possibly damaging 0.91
R9366:Mark1 UTSW 1 184,653,792 (GRCm39) missense probably damaging 1.00
R9462:Mark1 UTSW 1 184,651,868 (GRCm39) missense probably damaging 0.99
R9582:Mark1 UTSW 1 184,651,858 (GRCm39) missense possibly damaging 0.93
R9627:Mark1 UTSW 1 184,646,817 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TTGTGATGAGGCCATTCAAGG -3'
(R):5'- AGACTGCAGACCACTTTGTG -3'

Sequencing Primer
(F):5'- TGAGGCCATTCAAGGATATGTTAG -3'
(R):5'- AAGTAGTTTCCTTGCATGGGAG -3'
Posted On 2016-07-22