Incidental Mutation 'R5222:Esf1'
ID402356
Institutional Source Beutler Lab
Gene Symbol Esf1
Ensembl Gene ENSMUSG00000045624
Gene NameESF1 nucleolar pre-rRNA processing protein homolog
Synonyms
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location140119883-140170564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140158583 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 428 (Y428H)
Ref Sequence ENSEMBL: ENSMUSP00000036523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046030]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046030
AA Change: Y428H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036523
Gene: ENSMUSG00000045624
AA Change: Y428H

DomainStartEndE-ValueType
coiled coil region 91 114 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 230 258 N/A INTRINSIC
coiled coil region 261 293 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
coiled coil region 628 652 N/A INTRINSIC
low complexity region 667 692 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
Pfam:NUC153 753 781 4.1e-15 PFAM
low complexity region 784 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153769
Meta Mutation Damage Score 0.3743 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Esf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Esf1 APN 2 140167817 missense probably benign 0.09
IGL01075:Esf1 APN 2 140120745 missense probably benign 0.01
IGL01777:Esf1 APN 2 140157172 splice site probably null
IGL01863:Esf1 APN 2 140120679 missense probably benign 0.00
IGL01982:Esf1 APN 2 140164528 missense probably benign 0.00
IGL02040:Esf1 APN 2 140129261 missense possibly damaging 0.70
IGL02063:Esf1 APN 2 140164457 missense possibly damaging 0.88
IGL03063:Esf1 APN 2 140154786 unclassified probably benign
PIT4418001:Esf1 UTSW 2 140159777 missense probably benign 0.18
R0255:Esf1 UTSW 2 140148923 unclassified probably benign
R0388:Esf1 UTSW 2 140120871 missense possibly damaging 0.71
R0564:Esf1 UTSW 2 140158586 missense possibly damaging 0.86
R0655:Esf1 UTSW 2 140148879 missense probably benign 0.25
R0831:Esf1 UTSW 2 140168359 missense probably damaging 1.00
R1642:Esf1 UTSW 2 140158486 missense possibly damaging 0.85
R1984:Esf1 UTSW 2 140148886 missense possibly damaging 0.83
R3981:Esf1 UTSW 2 140158556 missense probably benign 0.40
R4736:Esf1 UTSW 2 140124971 missense probably damaging 0.98
R5083:Esf1 UTSW 2 140157071 missense possibly damaging 0.93
R5083:Esf1 UTSW 2 140158579 missense possibly damaging 0.96
R5347:Esf1 UTSW 2 140154881 nonsense probably null
R5654:Esf1 UTSW 2 140164228 missense possibly damaging 0.85
R6123:Esf1 UTSW 2 140168389 missense probably benign 0.01
R6132:Esf1 UTSW 2 140159779 missense probably benign 0.18
R6299:Esf1 UTSW 2 140123634 missense possibly damaging 0.53
R6484:Esf1 UTSW 2 140158538 missense probably benign 0.03
R6541:Esf1 UTSW 2 140167879 missense probably benign 0.00
R6674:Esf1 UTSW 2 140120806 nonsense probably null
R7203:Esf1 UTSW 2 140164219 missense possibly damaging 0.53
R7309:Esf1 UTSW 2 140125091 intron probably null
R7379:Esf1 UTSW 2 140154934 missense probably benign 0.33
R8131:Esf1 UTSW 2 140148831 nonsense probably null
RF006:Esf1 UTSW 2 140164374 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTTTTACTGCTTATGATCTTGCTA -3'
(R):5'- GAGCTGATATCTCACAAGCATATTTT -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- GTGCACGTACCTTTGGAA -3'
Posted On2016-07-22