Incidental Mutation 'R5222:Cd40'
List |< first << previous [record 5 of 51] next >> last >|
ID402357
Institutional Source Beutler Lab
Gene Symbol Cd40
Ensembl Gene ENSMUSG00000017652
Gene NameCD40 antigen
SynonymsBp50, Cd40, p50, Tnfrsf5
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165055627-165072948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 165066544 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 180 (S180T)
Ref Sequence ENSEMBL: ENSMUSP00000139193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017799] [ENSMUST00000073707] [ENSMUST00000081310] [ENSMUST00000140951] [ENSMUST00000154443] [ENSMUST00000184221]
Predicted Effect probably benign
Transcript: ENSMUST00000017799
AA Change: S180T

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017799
Gene: ENSMUSG00000017652
AA Change: S180T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073707
AA Change: S180T

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073386
Gene: ENSMUSG00000017652
AA Change: S180T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081310
SMART Domains Protein: ENSMUSP00000080059
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140951
SMART Domains Protein: ENSMUSP00000122981
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TNFR 64 97 9.45e-6 SMART
Blast:TNFR 100 121 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153105
Predicted Effect probably benign
Transcript: ENSMUST00000154443
Predicted Effect probably benign
Transcript: ENSMUST00000184221
AA Change: S180T

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139193
Gene: ENSMUSG00000017652
AA Change: S180T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene may cause impaired immunoglobulin class switching and germinal center formation, reduced susceptibility to type II hypersensitivity reaction, impaired priming of T cells and control of M. tuberculosis infection, and altered response to transplant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Cd40
AlleleSourceChrCoordTypePredicted EffectPPH Score
bluebonnet UTSW 2 165062301 missense probably benign 0.23
noelle UTSW 2 165063563 critical splice donor site probably null
R0553:Cd40 UTSW 2 165070741 missense probably benign 0.01
R1115:Cd40 UTSW 2 165070761 missense possibly damaging 0.59
R1134:Cd40 UTSW 2 165070818 missense probably benign 0.44
R2036:Cd40 UTSW 2 165062301 missense probably benign 0.23
R2938:Cd40 UTSW 2 165069702 missense probably benign 0.01
R3034:Cd40 UTSW 2 165062315 missense probably benign 0.02
R4690:Cd40 UTSW 2 165069695 missense possibly damaging 0.68
R5310:Cd40 UTSW 2 165063563 critical splice donor site probably null
R7318:Cd40 UTSW 2 165062335 missense possibly damaging 0.51
R7833:Cd40 UTSW 2 165066511 missense probably benign 0.01
R7905:Cd40 UTSW 2 165062325 missense probably damaging 1.00
R8069:Cd40 UTSW 2 165056775 missense unknown
R8371:Cd40 UTSW 2 165066538 missense probably damaging 1.00
Z1088:Cd40 UTSW 2 165063040 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGGACTTGCTGCTTGCTG -3'
(R):5'- ACCTGAACCTCAAGCAAGGG -3'

Sequencing Primer
(F):5'- CTGCTTGCTGGGGGACTC -3'
(R):5'- AAGGGATGTGACTTACCCAGCTC -3'
Posted On2016-07-22