Incidental Mutation 'R5222:Rtel1'
ID 402358
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Name regulator of telomere elongation helicase 1
Synonyms Nhl, Rtel, KIAA1088, C20ORF41
MMRRC Submission 042795-MU
Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Essential gene? Essential (E-score: 1.000) question?
Stock # R5222 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 181319739-181356616 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) G to T at 181346983 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000148252]
AlphaFold Q0VGM9
Predicted Effect probably benign
Transcript: ENSMUST00000048608
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054622
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098971
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108814
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108815
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146273
Predicted Effect probably benign
Transcript: ENSMUST00000148252
SMART Domains Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
Pfam:DEAD_2 1 88 1.3e-33 PFAM
HELICc 379 533 1.07e-62 SMART
low complexity region 858 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184751
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 181354401 missense probably benign 0.16
IGL01957:Rtel1 APN 2 181349313 unclassified probably benign
IGL02247:Rtel1 APN 2 181351341 nonsense probably null
IGL02414:Rtel1 APN 2 181335972 missense probably benign 0.01
IGL02448:Rtel1 APN 2 181336037 missense probably benign 0.00
IGL03053:Rtel1 APN 2 181351944 missense probably benign 0.02
IGL03059:Rtel1 APN 2 181350183 missense probably benign 0.01
IGL03326:Rtel1 APN 2 181355561 unclassified probably benign
PIT4283001:Rtel1 UTSW 2 181346890 missense probably benign 0.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0147:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0148:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0316:Rtel1 UTSW 2 181356002 missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 181351881 missense probably benign 0.03
R0940:Rtel1 UTSW 2 181322803 missense probably benign 0.36
R1165:Rtel1 UTSW 2 181334939 missense probably benign 0.26
R1213:Rtel1 UTSW 2 181351335 missense probably benign 0.01
R1291:Rtel1 UTSW 2 181351043 missense probably damaging 1.00
R1353:Rtel1 UTSW 2 181349231 missense probably benign
R1398:Rtel1 UTSW 2 181335865 splice site probably null
R1796:Rtel1 UTSW 2 181352103 missense probably benign 0.01
R1973:Rtel1 UTSW 2 181351626 missense probably benign 0.04
R2033:Rtel1 UTSW 2 181351863 nonsense probably null
R2144:Rtel1 UTSW 2 181323706 missense probably damaging 0.97
R2265:Rtel1 UTSW 2 181354368 missense probably damaging 1.00
R2269:Rtel1 UTSW 2 181336003 missense probably benign 0.00
R2416:Rtel1 UTSW 2 181340531 missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 181349972 missense probably benign 0.36
R3508:Rtel1 UTSW 2 181322409 missense probably benign 0.32
R4242:Rtel1 UTSW 2 181349934 missense probably damaging 1.00
R4377:Rtel1 UTSW 2 181355796 missense probably damaging 1.00
R4702:Rtel1 UTSW 2 181352169 missense probably benign 0.30
R4706:Rtel1 UTSW 2 181323746 critical splice donor site probably null
R4817:Rtel1 UTSW 2 181355935 missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 181322514 splice site probably null
R5069:Rtel1 UTSW 2 181355492 missense probably benign 0.03
R5268:Rtel1 UTSW 2 181340561 missense probably benign 0.03
R5291:Rtel1 UTSW 2 181352095 missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 181352100 missense probably benign
R5682:Rtel1 UTSW 2 181349972 missense probably benign 0.19
R5796:Rtel1 UTSW 2 181340506 missense probably benign 0.26
R5931:Rtel1 UTSW 2 181330815 nonsense probably null
R6249:Rtel1 UTSW 2 181351682 missense probably damaging 1.00
R6465:Rtel1 UTSW 2 181335940 missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 181352786 missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 181322463 missense probably benign 0.31
R6835:Rtel1 UTSW 2 181355953 missense probably benign 0.04
R6917:Rtel1 UTSW 2 181338277 makesense probably null
R7264:Rtel1 UTSW 2 181351861 missense not run
R7381:Rtel1 UTSW 2 181330815 nonsense probably null
R7523:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7587:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7681:Rtel1 UTSW 2 181322394 missense probably damaging 0.99
R7871:Rtel1 UTSW 2 181321029 missense probably damaging 1.00
R7912:Rtel1 UTSW 2 181356076 missense possibly damaging 0.56
R8007:Rtel1 UTSW 2 181334974 missense probably damaging 1.00
R8062:Rtel1 UTSW 2 181340567 missense probably benign 0.17
R8088:Rtel1 UTSW 2 181322345 missense probably damaging 1.00
R8435:Rtel1 UTSW 2 181354104 missense possibly damaging 0.93
R8873:Rtel1 UTSW 2 181356023 frame shift probably null
R9441:Rtel1 UTSW 2 181347067 missense possibly damaging 0.89
R9704:Rtel1 UTSW 2 181352112 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGATGTGTTCTCAACCCAGGC -3'
(R):5'- AGTGGGCATGACTCCAGATG -3'

Sequencing Primer
(F):5'- AACCCAGGCTCCCTTTCC -3'
(R):5'- GGCATGACTCCAGATGTGATG -3'
Posted On 2016-07-22