Incidental Mutation 'R5222:Pramel28'
ID 402360
Institutional Source Beutler Lab
Gene Symbol Pramel28
Ensembl Gene ENSMUSG00000078510
Gene Name PRAME like 28
Synonyms Gm13101
MMRRC Submission 042795-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R5222 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 143691088-143693520 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143691362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 454 (I454F)
Ref Sequence ENSEMBL: ENSMUSP00000101389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105763]
AlphaFold A2ASJ0
Predicted Effect possibly damaging
Transcript: ENSMUST00000105763
AA Change: I454F

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101389
Gene: ENSMUSG00000078510
AA Change: I454F

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 2e-9 SMART
Meta Mutation Damage Score 0.1772 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 159,872,178 (GRCm39) noncoding transcript Het
Acad11 G A 9: 103,974,576 (GRCm39) A515T probably damaging Het
Angpt1 T C 15: 42,539,730 (GRCm39) Y43C probably damaging Het
Arhgef33 A G 17: 80,644,743 (GRCm39) Y24C probably damaging Het
Cd40 G C 2: 164,908,464 (GRCm39) S180T probably benign Het
Cenpc1 A T 5: 86,185,606 (GRCm39) S302T possibly damaging Het
Cit C A 5: 116,090,602 (GRCm39) T932K probably benign Het
Col19a1 A C 1: 24,598,721 (GRCm39) probably null Het
Dapk3 A G 10: 81,028,294 (GRCm39) E288G probably damaging Het
Ddx60 T C 8: 62,437,192 (GRCm39) F1002S probably damaging Het
Dgke G T 11: 88,941,220 (GRCm39) T321K probably benign Het
Ebf2 T G 14: 67,551,043 (GRCm39) probably benign Het
Enpp7 A G 11: 118,881,788 (GRCm39) D311G probably benign Het
Epm2a A G 10: 11,324,493 (GRCm39) E194G probably damaging Het
Esf1 A G 2: 140,000,503 (GRCm39) Y428H possibly damaging Het
Esyt2 T C 12: 116,282,446 (GRCm39) F132S probably damaging Het
Gm5455 T C 13: 110,441,494 (GRCm39) noncoding transcript Het
Gria1 T A 11: 57,080,623 (GRCm39) V202E probably benign Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Mark1 A T 1: 184,660,288 (GRCm39) F123I probably damaging Het
Nectin4 T A 1: 171,212,825 (GRCm39) probably null Het
Obscn T A 11: 58,934,971 (GRCm39) T5220S possibly damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2l13 A C 16: 19,305,680 (GRCm39) I31L probably benign Het
Or2p2 T A 13: 21,256,739 (GRCm39) H244L probably damaging Het
Pdcd1 A T 1: 93,980,175 (GRCm39) V14E probably damaging Het
Pmel A G 10: 128,554,853 (GRCm39) probably null Het
Prrx1 C T 1: 163,089,542 (GRCm39) R95Q probably damaging Het
Pstpip2 T A 18: 77,962,032 (GRCm39) Y267* probably null Het
Ptprq A G 10: 107,498,425 (GRCm39) I884T probably damaging Het
Rad17 G A 13: 100,770,399 (GRCm39) T216I possibly damaging Het
Rif1 T C 2: 51,967,032 (GRCm39) I107T probably benign Het
Rpp14 T C 14: 8,087,513 (GRCm38) L69P probably damaging Het
Rtel1 G T 2: 180,988,776 (GRCm39) probably benign Het
Sap130 C T 18: 31,799,756 (GRCm39) T362M probably damaging Het
Scn11a A G 9: 119,644,268 (GRCm39) probably null Het
Sec31a G T 5: 100,530,754 (GRCm39) T243N probably benign Het
Slc5a9 T A 4: 111,755,808 (GRCm39) H30L possibly damaging Het
Slco6b1 T A 1: 96,925,216 (GRCm39) noncoding transcript Het
Smarca4 A G 9: 21,567,002 (GRCm39) D694G probably benign Het
Spaca6 A G 17: 18,058,367 (GRCm39) T213A probably benign Het
Tagap C A 17: 8,152,473 (GRCm39) Q553K possibly damaging Het
Tagap A T 17: 8,152,474 (GRCm39) Q553L possibly damaging Het
Tcf7l2 A G 19: 55,887,044 (GRCm39) Q19R probably benign Het
Ttn A G 2: 76,709,197 (GRCm39) probably benign Het
Ubr7 A T 12: 102,741,964 (GRCm39) R399S probably benign Het
Uspl1 C A 5: 149,150,911 (GRCm39) Q690K possibly damaging Het
Vps8 T A 16: 21,400,298 (GRCm39) Y853* probably null Het
Vrk3 A T 7: 44,409,220 (GRCm39) Q129L possibly damaging Het
Wapl T A 14: 34,458,642 (GRCm39) C901* probably null Het
Other mutations in Pramel28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Pramel28 APN 4 143,693,184 (GRCm39) splice site probably benign
IGL00688:Pramel28 APN 4 143,692,392 (GRCm39) missense possibly damaging 0.62
IGL00690:Pramel28 APN 4 143,692,392 (GRCm39) missense possibly damaging 0.62
IGL00693:Pramel28 APN 4 143,692,392 (GRCm39) missense possibly damaging 0.62
IGL00694:Pramel28 APN 4 143,692,392 (GRCm39) missense possibly damaging 0.62
IGL01412:Pramel28 APN 4 143,691,565 (GRCm39) missense probably damaging 1.00
IGL01781:Pramel28 APN 4 143,692,299 (GRCm39) missense probably benign
IGL02426:Pramel28 APN 4 143,693,229 (GRCm39) missense possibly damaging 0.75
IGL02508:Pramel28 APN 4 143,691,590 (GRCm39) missense probably benign 0.13
IGL03338:Pramel28 APN 4 143,692,608 (GRCm39) missense probably benign 0.03
IGL03338:Pramel28 APN 4 143,692,411 (GRCm39) missense probably benign 0.01
R0201:Pramel28 UTSW 4 143,691,460 (GRCm39) missense probably damaging 1.00
R0325:Pramel28 UTSW 4 143,693,310 (GRCm39) missense probably damaging 1.00
R0538:Pramel28 UTSW 4 143,691,653 (GRCm39) missense possibly damaging 0.76
R1471:Pramel28 UTSW 4 143,691,523 (GRCm39) missense probably benign 0.25
R1544:Pramel28 UTSW 4 143,692,632 (GRCm39) missense probably benign 0.00
R1891:Pramel28 UTSW 4 143,693,235 (GRCm39) missense probably damaging 1.00
R2012:Pramel28 UTSW 4 143,692,637 (GRCm39) missense probably benign 0.00
R2105:Pramel28 UTSW 4 143,692,390 (GRCm39) missense probably benign
R2939:Pramel28 UTSW 4 143,693,247 (GRCm39) missense probably benign 0.00
R2940:Pramel28 UTSW 4 143,693,247 (GRCm39) missense probably benign 0.00
R3723:Pramel28 UTSW 4 143,693,251 (GRCm39) missense probably benign
R3952:Pramel28 UTSW 4 143,692,356 (GRCm39) nonsense probably null
R4028:Pramel28 UTSW 4 143,692,354 (GRCm39) missense probably benign 0.02
R4029:Pramel28 UTSW 4 143,692,354 (GRCm39) missense probably benign 0.02
R4030:Pramel28 UTSW 4 143,692,354 (GRCm39) missense probably benign 0.02
R5059:Pramel28 UTSW 4 143,691,565 (GRCm39) missense probably damaging 0.99
R5591:Pramel28 UTSW 4 143,691,530 (GRCm39) missense probably damaging 1.00
R5677:Pramel28 UTSW 4 143,691,708 (GRCm39) missense possibly damaging 0.59
R6021:Pramel28 UTSW 4 143,692,336 (GRCm39) missense probably benign
R6042:Pramel28 UTSW 4 143,692,631 (GRCm39) missense probably benign 0.04
R6155:Pramel28 UTSW 4 143,691,712 (GRCm39) missense probably benign 0.00
R6604:Pramel28 UTSW 4 143,692,567 (GRCm39) missense probably benign 0.02
R6807:Pramel28 UTSW 4 143,691,581 (GRCm39) missense probably damaging 1.00
R7244:Pramel28 UTSW 4 143,692,455 (GRCm39) missense probably benign
R7505:Pramel28 UTSW 4 143,691,556 (GRCm39) missense probably benign 0.00
R7526:Pramel28 UTSW 4 143,692,387 (GRCm39) missense probably benign 0.00
R8121:Pramel28 UTSW 4 143,691,611 (GRCm39) missense probably benign 0.01
R8408:Pramel28 UTSW 4 143,692,212 (GRCm39) missense probably benign
R8890:Pramel28 UTSW 4 143,691,494 (GRCm39) missense probably benign 0.10
R8989:Pramel28 UTSW 4 143,691,770 (GRCm39) missense probably benign 0.04
R9054:Pramel28 UTSW 4 143,692,314 (GRCm39) missense probably benign 0.18
R9622:Pramel28 UTSW 4 143,692,348 (GRCm39) missense probably benign 0.00
Z1088:Pramel28 UTSW 4 143,692,132 (GRCm39) missense probably benign
Z1177:Pramel28 UTSW 4 143,692,345 (GRCm39) missense probably benign 0.02
Z1177:Pramel28 UTSW 4 143,692,161 (GRCm39) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AGACATGTGTTCAGGAACCC -3'
(R):5'- CCCTGAATAAGTGCTCTCAGC -3'

Sequencing Primer
(F):5'- GTGTTCAGGAACCCCTTGATCATAG -3'
(R):5'- CGGTCAACTTCTGTGACAATGAC -3'
Posted On 2016-07-22