Mutagenetix > Incidental Mutation

Incidental Mutation 'R5222:Cenpc1'

402361

Institutional Source

Beutler Lab

Gene Symbol

Cenpc1

Ensembl Gene

ENSMUSG00000029253

Gene Name

centromere protein C1

Synonyms

MMRRC Submission

042795-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5222 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86012024-86065583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86037747 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 302 (S302T)

Ref Sequence

ENSEMBL: ENSMUSP00000031170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031170]

AlphaFold

P49452

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031170
AA Change: S302T

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000031170
Gene: ENSMUSG00000029253
AA Change: S302T

Domain	Start	End	E-Value	Type
Pfam:CENP_C_N	7	121	6.1e-42	PFAM
Pfam:CENP_C_N	115	261	2.6e-46	PFAM
Pfam:CENP-C_mid	265	519	5.4e-100	PFAM
PDB:4INM\|W	700	724	5e-9	PDB
Pfam:CENP-C_C	819	903	3.9e-28	PFAM

Meta Mutation Damage Score

0.0862

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: This gene encodes a centromeric protein component of a nucleosome-associated complex that plays a central role in kinetochore protein assembly, mitotic progression and chromosome segregation. The human ortholog encodes a protein with DNA-binding activity, that associates constitutively to kinetochores throughout the cell cycle, as part of a prekinetochore complex, together with centromeric protein-A and centromeric protein-B. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality and mitotic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	C	A	1: 160,044,608		noncoding transcript	Het
Acad11	G	A	9: 104,097,377	A515T	probably damaging	Het
Angpt1	T	C	15: 42,676,334	Y43C	probably damaging	Het
Arhgef33	A	G	17: 80,337,314	Y24C	probably damaging	Het
Cd40	G	C	2: 165,066,544	S180T	probably benign	Het
Cit	C	A	5: 115,952,543	T932K	probably benign	Het
Col19a1	A	C	1: 24,559,640		probably null	Het
Dapk3	A	G	10: 81,192,460	E288G	probably damaging	Het
Ddx60	T	C	8: 61,984,158	F1002S	probably damaging	Het
Dgke	G	T	11: 89,050,394	T321K	probably benign	Het
Ebf2	T	G	14: 67,313,594		probably benign	Het
Enpp7	A	G	11: 118,990,962	D311G	probably benign	Het
Epm2a	A	G	10: 11,448,749	E194G	probably damaging	Het
Esf1	A	G	2: 140,158,583	Y428H	possibly damaging	Het
Esyt2	T	C	12: 116,318,826	F132S	probably damaging	Het
Gm13101	T	A	4: 143,964,792	I454F	possibly damaging	Het
Gm5455	T	C	13: 110,304,960		noncoding transcript	Het
Gria1	T	A	11: 57,189,797	V202E	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Mark1	A	T	1: 184,928,091	F123I	probably damaging	Het
Nectin4	T	A	1: 171,385,257		probably null	Het
Obscn	T	A	11: 59,044,145	T5220S	possibly damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1370	T	A	13: 21,072,569	H244L	probably damaging	Het
Olfr166	A	C	16: 19,486,930	I31L	probably benign	Het
Pdcd1	A	T	1: 94,052,450	V14E	probably damaging	Het
Pmel	A	G	10: 128,718,984		probably null	Het
Prrx1	C	T	1: 163,261,973	R95Q	probably damaging	Het
Pstpip2	T	A	18: 77,874,332	Y267*	probably null	Het
Ptprq	A	G	10: 107,662,564	I884T	probably damaging	Het
Rad17	G	A	13: 100,633,891	T216I	possibly damaging	Het
Rif1	T	C	2: 52,077,020	I107T	probably benign	Het
Rpp14	T	C	14: 8,087,513	L69P	probably damaging	Het
Rtel1	G	T	2: 181,346,983		probably benign	Het
Sap130	C	T	18: 31,666,703	T362M	probably damaging	Het
Scn11a	A	G	9: 119,815,202		probably null	Het
Sec31a	G	T	5: 100,382,895	T243N	probably benign	Het
Slc5a9	T	A	4: 111,898,611	H30L	possibly damaging	Het
Slco6b1	T	A	1: 96,997,491		noncoding transcript	Het
Smarca4	A	G	9: 21,655,706	D694G	probably benign	Het
Spaca6	A	G	17: 17,838,105	T213A	probably benign	Het
Tagap	C	A	17: 7,933,641	Q553K	possibly damaging	Het
Tagap	A	T	17: 7,933,642	Q553L	possibly damaging	Het
Tcf7l2	A	G	19: 55,898,612	Q19R	probably benign	Het
Ttn	A	G	2: 76,878,853		probably benign	Het
Ubr7	A	T	12: 102,775,705	R399S	probably benign	Het
Uspl1	C	A	5: 149,214,101	Q690K	possibly damaging	Het
Vps8	T	A	16: 21,581,548	Y853*	probably null	Het
Vrk3	A	T	7: 44,759,796	Q129L	possibly damaging	Het
Wapl	T	A	14: 34,736,685	C901*	probably null	Het

Other mutations in Cenpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00921:Cenpc1	APN	5	86037528	missense	probably benign	0.02
IGL01287:Cenpc1	APN	5	86022454	nonsense	probably null
IGL01363:Cenpc1	APN	5	86046531	nonsense	probably null
IGL01720:Cenpc1	APN	5	86045425	missense	possibly damaging	0.84
IGL02217:Cenpc1	APN	5	86029200	splice site	probably benign
IGL02665:Cenpc1	APN	5	86046403	missense	probably benign	0.01
IGL03022:Cenpc1	APN	5	86022375	splice site	probably benign
IGL03162:Cenpc1	APN	5	86037905	missense	possibly damaging	0.94
IGL03343:Cenpc1	APN	5	86016322	missense	probably damaging	0.96
R0130:Cenpc1	UTSW	5	86046546	missense	probably benign	0.07
R0193:Cenpc1	UTSW	5	86032403	missense	probably benign	0.30
R0314:Cenpc1	UTSW	5	86037371	missense	probably benign	0.20
R0932:Cenpc1	UTSW	5	86037600	missense	possibly damaging	0.94
R0973:Cenpc1	UTSW	5	86037908	missense	probably damaging	1.00
R0973:Cenpc1	UTSW	5	86037908	missense	probably damaging	1.00
R0974:Cenpc1	UTSW	5	86037908	missense	probably damaging	1.00
R1240:Cenpc1	UTSW	5	86035510	missense	probably benign	0.32
R1454:Cenpc1	UTSW	5	86013510	missense	possibly damaging	0.71
R1677:Cenpc1	UTSW	5	86061998	splice site	probably benign
R2044:Cenpc1	UTSW	5	86037755	missense	probably benign	0.01
R2256:Cenpc1	UTSW	5	86016203	missense	probably damaging	1.00
R3085:Cenpc1	UTSW	5	86037617	missense	probably benign	0.01
R4516:Cenpc1	UTSW	5	86047587	missense	possibly damaging	0.72
R4518:Cenpc1	UTSW	5	86047587	missense	possibly damaging	0.72
R4561:Cenpc1	UTSW	5	86047632	missense	probably damaging	1.00
R4827:Cenpc1	UTSW	5	86034431	missense	possibly damaging	0.67
R4864:Cenpc1	UTSW	5	86045321	missense	probably damaging	1.00
R5707:Cenpc1	UTSW	5	86035434	missense	possibly damaging	0.82
R5920:Cenpc1	UTSW	5	86020910	missense	probably benign	0.00
R5999:Cenpc1	UTSW	5	86012263	missense	probably damaging	1.00
R6073:Cenpc1	UTSW	5	86058153	critical splice donor site	probably null
R6209:Cenpc1	UTSW	5	86033650	missense	probably benign	0.02
R6244:Cenpc1	UTSW	5	86046385	missense	probably damaging	1.00
R6278:Cenpc1	UTSW	5	86035535	missense	probably damaging	0.97
R6395:Cenpc1	UTSW	5	86035570	missense	probably benign	0.14
R7269:Cenpc1	UTSW	5	86013507	missense	probably damaging	1.00
R7269:Cenpc1	UTSW	5	86032418	missense	probably benign	0.12
R7335:Cenpc1	UTSW	5	86034353	missense	possibly damaging	0.95
R7378:Cenpc1	UTSW	5	86046499	missense	probably benign	0.02
R7968:Cenpc1	UTSW	5	86033692	missense	probably benign
R8380:Cenpc1	UTSW	5	86046416	missense	probably benign	0.00
R8780:Cenpc1	UTSW	5	86016350	missense	probably damaging	1.00
R8859:Cenpc1	UTSW	5	86012294	missense	probably benign	0.02
R8982:Cenpc1	UTSW	5	86047674	missense	probably damaging	1.00
R9157:Cenpc1	UTSW	5	86018457	missense	probably benign	0.00
RF018:Cenpc1	UTSW	5	86045369	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TAGGCTTAGACACTCTCCTCTGG -3'
(R):5'- AGTTCTGTGGTCAGGCACAC -3'

Sequencing Primer
(F):5'- CAGGAGATCGACAATCATTTTCC -3'
(R):5'- ACACAGCAGCAGTTCCATTTTC -3'

Posted On

2016-07-22