Mutagenetix > Incidental Mutation

Incidental Mutation 'R5222:Sec31a'

402362

Institutional Source

Beutler Lab

Gene Symbol

Sec31a

Ensembl Gene

ENSMUSG00000035325

Gene Name

Sec31 homolog A (S. cerevisiae)

Synonyms

Sec31l1, 1810024J13Rik

MMRRC Submission

042795-MU

Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Essential gene?

Probably essential (E-score: 0.852) question?

Stock #

R5222 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100361649-100416234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 100382895 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 243 (T243N)

Ref Sequence

ENSEMBL: ENSMUSP00000138129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]

AlphaFold

Q3UPL0

Predicted Effect

probably benign
Transcript: ENSMUST00000094578
AA Change: T673N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: T673N

Domain	Start	End	E-Value	Type
WD40	56	102	1.59e1	SMART
WD40	111	151	5.15e-2	SMART
WD40	158	197	5.16e-1	SMART
WD40	200	245	6.63e0	SMART
WD40	249	289	1.95e-2	SMART
WD40	292	332	4.24e-3	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	572	769	3.5e-7	PFAM
low complexity region	866	882	N/A	INTRINSIC
low complexity region	930	949	N/A	INTRINSIC
low complexity region	953	975	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182002

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182569

Predicted Effect

probably benign
Transcript: ENSMUST00000182812

Predicted Effect

probably benign
Transcript: ENSMUST00000182886
AA Change: T634N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: T634N

Domain	Start	End	E-Value	Type
WD40	56	102	1e-1	SMART
WD40	111	151	3.3e-4	SMART
WD40	158	197	3.2e-3	SMART
WD40	200	245	4.1e-2	SMART
WD40	249	289	1.2e-4	SMART
WD40	292	332	2.6e-5	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	532	731	2.1e-6	PFAM
low complexity region	827	843	N/A	INTRINSIC
low complexity region	891	910	N/A	INTRINSIC
low complexity region	914	936	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000182988
AA Change: T373N

Predicted Effect

probably benign
Transcript: ENSMUST00000183247
AA Change: T243N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325
AA Change: T243N

Domain	Start	End	E-Value	Type
Pfam:Sec16_C	141	248	1.5e-7	PFAM

Meta Mutation Damage Score

0.0606

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	C	A	1: 160,044,608		noncoding transcript	Het
Acad11	G	A	9: 104,097,377	A515T	probably damaging	Het
Angpt1	T	C	15: 42,676,334	Y43C	probably damaging	Het
Arhgef33	A	G	17: 80,337,314	Y24C	probably damaging	Het
Cd40	G	C	2: 165,066,544	S180T	probably benign	Het
Cenpc1	A	T	5: 86,037,747	S302T	possibly damaging	Het
Cit	C	A	5: 115,952,543	T932K	probably benign	Het
Col19a1	A	C	1: 24,559,640		probably null	Het
Dapk3	A	G	10: 81,192,460	E288G	probably damaging	Het
Ddx60	T	C	8: 61,984,158	F1002S	probably damaging	Het
Dgke	G	T	11: 89,050,394	T321K	probably benign	Het
Ebf2	T	G	14: 67,313,594		probably benign	Het
Enpp7	A	G	11: 118,990,962	D311G	probably benign	Het
Epm2a	A	G	10: 11,448,749	E194G	probably damaging	Het
Esf1	A	G	2: 140,158,583	Y428H	possibly damaging	Het
Esyt2	T	C	12: 116,318,826	F132S	probably damaging	Het
Gm13101	T	A	4: 143,964,792	I454F	possibly damaging	Het
Gm5455	T	C	13: 110,304,960		noncoding transcript	Het
Gria1	T	A	11: 57,189,797	V202E	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Mark1	A	T	1: 184,928,091	F123I	probably damaging	Het
Nectin4	T	A	1: 171,385,257		probably null	Het
Obscn	T	A	11: 59,044,145	T5220S	possibly damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1370	T	A	13: 21,072,569	H244L	probably damaging	Het
Olfr166	A	C	16: 19,486,930	I31L	probably benign	Het
Pdcd1	A	T	1: 94,052,450	V14E	probably damaging	Het
Pmel	A	G	10: 128,718,984		probably null	Het
Prrx1	C	T	1: 163,261,973	R95Q	probably damaging	Het
Pstpip2	T	A	18: 77,874,332	Y267*	probably null	Het
Ptprq	A	G	10: 107,662,564	I884T	probably damaging	Het
Rad17	G	A	13: 100,633,891	T216I	possibly damaging	Het
Rif1	T	C	2: 52,077,020	I107T	probably benign	Het
Rpp14	T	C	14: 8,087,513	L69P	probably damaging	Het
Rtel1	G	T	2: 181,346,983		probably benign	Het
Sap130	C	T	18: 31,666,703	T362M	probably damaging	Het
Scn11a	A	G	9: 119,815,202		probably null	Het
Slc5a9	T	A	4: 111,898,611	H30L	possibly damaging	Het
Slco6b1	T	A	1: 96,997,491		noncoding transcript	Het
Smarca4	A	G	9: 21,655,706	D694G	probably benign	Het
Spaca6	A	G	17: 17,838,105	T213A	probably benign	Het
Tagap	C	A	17: 7,933,641	Q553K	possibly damaging	Het
Tagap	A	T	17: 7,933,642	Q553L	possibly damaging	Het
Tcf7l2	A	G	19: 55,898,612	Q19R	probably benign	Het
Ttn	A	G	2: 76,878,853		probably benign	Het
Ubr7	A	T	12: 102,775,705	R399S	probably benign	Het
Uspl1	C	A	5: 149,214,101	Q690K	possibly damaging	Het
Vps8	T	A	16: 21,581,548	Y853*	probably null	Het
Vrk3	A	T	7: 44,759,796	Q129L	possibly damaging	Het
Wapl	T	A	14: 34,736,685	C901*	probably null	Het

Other mutations in Sec31a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Sec31a	APN	5	100404017	nonsense	probably null
IGL01610:Sec31a	APN	5	100402358	splice site	probably benign
IGL01804:Sec31a	APN	5	100375206	critical splice donor site	probably null
IGL02026:Sec31a	APN	5	100369626	missense	probably benign	0.04
IGL02150:Sec31a	APN	5	100386125	splice site	probably benign
IGL02237:Sec31a	APN	5	100362055	missense	probably damaging	1.00
IGL02469:Sec31a	APN	5	100385255	missense	probably benign	0.02
IGL02512:Sec31a	APN	5	100407193	missense	probably damaging	0.99
control	UTSW	5	100362173	missense	probably damaging	1.00
D3080:Sec31a	UTSW	5	100363832	missense	probably damaging	1.00
PIT4142001:Sec31a	UTSW	5	100407275	missense	probably damaging	1.00
R0366:Sec31a	UTSW	5	100382766	missense	probably damaging	1.00
R0453:Sec31a	UTSW	5	100404118	splice site	probably benign
R0511:Sec31a	UTSW	5	100375240	missense	probably benign	0.01
R0546:Sec31a	UTSW	5	100404070	missense	probably damaging	1.00
R0675:Sec31a	UTSW	5	100393207	missense	probably damaging	0.97
R0678:Sec31a	UTSW	5	100407225	missense	possibly damaging	0.74
R0975:Sec31a	UTSW	5	100395904	splice site	probably null
R1146:Sec31a	UTSW	5	100362173	missense	probably damaging	1.00
R1146:Sec31a	UTSW	5	100362173	missense	probably damaging	1.00
R1540:Sec31a	UTSW	5	100375319	missense	probably damaging	1.00
R1616:Sec31a	UTSW	5	100386195	missense	possibly damaging	0.88
R1780:Sec31a	UTSW	5	100381336	splice site	probably null
R2472:Sec31a	UTSW	5	100385205	missense	probably damaging	1.00
R3689:Sec31a	UTSW	5	100382907	missense	probably damaging	1.00
R4515:Sec31a	UTSW	5	100365958	missense	probably damaging	0.99
R4801:Sec31a	UTSW	5	100393363	missense	probably damaging	0.96
R4802:Sec31a	UTSW	5	100393363	missense	probably damaging	0.96
R4896:Sec31a	UTSW	5	100368333	missense	probably damaging	1.00
R5004:Sec31a	UTSW	5	100368333	missense	probably damaging	1.00
R5053:Sec31a	UTSW	5	100393214	missense	possibly damaging	0.94
R5158:Sec31a	UTSW	5	100393321	missense	probably damaging	0.99
R5191:Sec31a	UTSW	5	100405511	missense	possibly damaging	0.75
R5405:Sec31a	UTSW	5	100383798	nonsense	probably null
R5436:Sec31a	UTSW	5	100363839	missense	probably damaging	0.98
R5577:Sec31a	UTSW	5	100402274	missense	possibly damaging	0.95
R6005:Sec31a	UTSW	5	100363878	missense	probably damaging	1.00
R6184:Sec31a	UTSW	5	100369594	critical splice donor site	probably null
R6245:Sec31a	UTSW	5	100386184	missense	probably benign	0.07
R6475:Sec31a	UTSW	5	100385270	missense	probably damaging	1.00
R6476:Sec31a	UTSW	5	100386149	missense	probably benign	0.03
R6744:Sec31a	UTSW	5	100392499	missense	possibly damaging	0.47
R6804:Sec31a	UTSW	5	100382812	missense	probably benign	0.03
R6911:Sec31a	UTSW	5	100393264	missense	possibly damaging	0.92
R6936:Sec31a	UTSW	5	100392510	missense	probably benign
R7345:Sec31a	UTSW	5	100385270	missense	probably damaging	1.00
R7760:Sec31a	UTSW	5	100392628	missense	probably damaging	1.00
R7898:Sec31a	UTSW	5	100399477	missense	probably damaging	0.99
R8088:Sec31a	UTSW	5	100378862	missense
R8555:Sec31a	UTSW	5	100392414	missense	probably benign	0.25
R8762:Sec31a	UTSW	5	100378829	missense
R9055:Sec31a	UTSW	5	100386181	missense	possibly damaging	0.75
R9173:Sec31a	UTSW	5	100381288	missense	possibly damaging	0.85
R9249:Sec31a	UTSW	5	100385224	missense	probably damaging	0.98
X0003:Sec31a	UTSW	5	100399354	missense	probably damaging	0.98
Z1177:Sec31a	UTSW	5	100383845	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAAAAGCATTTCTAGCTCAGCG -3'
(R):5'- GCGTTCAGAGTTCTTCGTTC -3'

Sequencing Primer
(F):5'- CTGAGGGCACGCTGAAAC -3'
(R):5'- GTTCAGAGTTCTTCGTTCCTATTTTC -3'

Posted On

2016-07-22