Incidental Mutation 'R5222:Uspl1'
ID402364
Institutional Source Beutler Lab
Gene Symbol Uspl1
Ensembl Gene ENSMUSG00000041264
Gene Nameubiquitin specific peptidase like 1
SynonymsE430026A01Rik
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location149184350-149215434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 149214101 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 690 (Q690K)
Ref Sequence ENSEMBL: ENSMUSP00000114104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050472] [ENSMUST00000100410] [ENSMUST00000117878] [ENSMUST00000119685] [ENSMUST00000121416] [ENSMUST00000122160] [ENSMUST00000126168]
Predicted Effect probably benign
Transcript: ENSMUST00000050472
AA Change: Q704K

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000050172
Gene: ENSMUSG00000041264
AA Change: Q704K

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 7e-139 PFAM
Pfam:DUF4650 557 1087 1.9e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100410
SMART Domains Protein: ENSMUSP00000097978
Gene: ENSMUSG00000041264

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 1.4e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117878
SMART Domains Protein: ENSMUSP00000113176
Gene: ENSMUSG00000041264

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 5.6e-140 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119685
AA Change: Q690K

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114104
Gene: ENSMUSG00000041264
AA Change: Q690K

DomainStartEndE-ValueType
low complexity region 160 178 N/A INTRINSIC
Pfam:Peptidase_C98 199 472 6.9e-139 PFAM
Pfam:DUF4650 543 1073 1.8e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121416
AA Change: Q505K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113894
Gene: ENSMUSG00000041264
AA Change: Q505K

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 8.5e-139 PFAM
Pfam:DUF4650 358 888 1.5e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122160
AA Change: Q704K

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113247
Gene: ENSMUSG00000041264
AA Change: Q704K

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 214 486 2.5e-125 PFAM
Pfam:DUF4650 558 1087 1e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150921
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Uspl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Uspl1 APN 5 149215214 missense possibly damaging 0.95
IGL00571:Uspl1 APN 5 149188360 missense probably damaging 0.99
IGL01134:Uspl1 APN 5 149204293 missense probably damaging 1.00
IGL02222:Uspl1 APN 5 149194044 missense probably benign 0.25
IGL02383:Uspl1 APN 5 149213402 missense probably damaging 0.98
IGL02538:Uspl1 APN 5 149188459 missense probably damaging 1.00
IGL02546:Uspl1 APN 5 149204304 missense possibly damaging 0.95
IGL02585:Uspl1 APN 5 149214062 nonsense probably null
IGL02971:Uspl1 APN 5 149188346 missense possibly damaging 0.84
R0020:Uspl1 UTSW 5 149209779 missense probably damaging 1.00
R0070:Uspl1 UTSW 5 149209705 missense probably damaging 1.00
R0142:Uspl1 UTSW 5 149188349 missense possibly damaging 0.68
R0433:Uspl1 UTSW 5 149214815 missense probably damaging 1.00
R0554:Uspl1 UTSW 5 149187834 missense probably damaging 1.00
R0612:Uspl1 UTSW 5 149214957 missense probably damaging 1.00
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1465:Uspl1 UTSW 5 149214032 missense probably benign 0.12
R1465:Uspl1 UTSW 5 149214032 missense probably benign 0.12
R1623:Uspl1 UTSW 5 149215199 missense probably damaging 1.00
R1737:Uspl1 UTSW 5 149201858 missense probably damaging 1.00
R1793:Uspl1 UTSW 5 149213436 missense probably damaging 1.00
R1823:Uspl1 UTSW 5 149214414 missense probably benign 0.25
R2088:Uspl1 UTSW 5 149209750 missense probably damaging 1.00
R2099:Uspl1 UTSW 5 149214758 missense probably damaging 1.00
R2497:Uspl1 UTSW 5 149187854 missense probably damaging 0.98
R2944:Uspl1 UTSW 5 149201796 missense probably damaging 1.00
R3437:Uspl1 UTSW 5 149214697 utr 3 prime probably benign
R4132:Uspl1 UTSW 5 149204349 missense probably damaging 0.99
R4458:Uspl1 UTSW 5 149214152 missense possibly damaging 0.82
R4537:Uspl1 UTSW 5 149187778 missense possibly damaging 0.66
R4623:Uspl1 UTSW 5 149214595 missense probably damaging 0.99
R4633:Uspl1 UTSW 5 149214392 missense probably damaging 1.00
R4737:Uspl1 UTSW 5 149194339 missense possibly damaging 0.86
R4743:Uspl1 UTSW 5 149209756 missense probably damaging 1.00
R5200:Uspl1 UTSW 5 149214113 missense probably benign 0.02
R5337:Uspl1 UTSW 5 149214746 missense probably damaging 0.99
R5496:Uspl1 UTSW 5 149209779 missense probably damaging 1.00
R5654:Uspl1 UTSW 5 149209711 missense probably damaging 1.00
R5845:Uspl1 UTSW 5 149193960 missense probably benign 0.01
R6266:Uspl1 UTSW 5 149204366 missense probably damaging 1.00
R6331:Uspl1 UTSW 5 149214287 missense probably benign 0.40
R6338:Uspl1 UTSW 5 149215034 missense probably benign 0.03
R6774:Uspl1 UTSW 5 149214094 missense probably benign 0.00
R6855:Uspl1 UTSW 5 149187845 missense probably damaging 1.00
R7131:Uspl1 UTSW 5 149193935 missense probably benign 0.00
R7152:Uspl1 UTSW 5 149187778 missense possibly damaging 0.66
R7446:Uspl1 UTSW 5 149204272 nonsense probably null
R7661:Uspl1 UTSW 5 149215017 missense probably benign 0.15
X0019:Uspl1 UTSW 5 149214267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCCCATCCCAAGCTGTG -3'
(R):5'- TGCAGGTCACTTACTGCTC -3'

Sequencing Primer
(F):5'- TGTGAGCACAGACCTGCAG -3'
(R):5'- TCTACTCTGAGACAAAACACAGGTTG -3'
Posted On2016-07-22