Incidental Mutation 'R5222:Vrk3'
List |< first << previous [record 50 of 51] next >> last >|
ID402365
Institutional Source Beutler Lab
Gene Symbol Vrk3
Ensembl Gene ENSMUSG00000002205
Gene Namevaccinia related kinase 3
Synonyms
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44748413-44777515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44759796 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 129 (Q129L)
Ref Sequence ENSEMBL: ENSMUSP00000130331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002275] [ENSMUST00000144515] [ENSMUST00000147952] [ENSMUST00000165957] [ENSMUST00000171821]
Predicted Effect probably benign
Transcript: ENSMUST00000002275
AA Change: Q129L

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000002275
Gene: ENSMUSG00000002205
AA Change: Q129L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 212 432 3.2e-8 PFAM
Pfam:Pkinase 218 432 4.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136069
Predicted Effect probably benign
Transcript: ENSMUST00000144515
SMART Domains Protein: ENSMUSP00000119073
Gene: ENSMUSG00000002205

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 1.2e-11 PFAM
Pfam:zinc_ribbon_2 4 26 3e-10 PFAM
PDB:2JII|B 97 176 3e-36 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000147952
AA Change: Q129L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130331
Gene: ENSMUSG00000002205
AA Change: Q129L

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 1.1e-11 PFAM
Pfam:zinc_ribbon_2 4 26 2.9e-10 PFAM
PDB:2JII|B 117 162 1e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000165957
AA Change: Q129L

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131704
Gene: ENSMUSG00000002205
AA Change: Q129L

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 6.7e-12 PFAM
Pfam:zinc_ribbon_2 4 26 4.4e-10 PFAM
PDB:2JII|B 117 204 7e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171821
SMART Domains Protein: ENSMUSP00000132748
Gene: ENSMUSG00000002205

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 2.9e-12 PFAM
Pfam:zinc_ribbon_2 4 26 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208083
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. In both human and mouse, this gene has substitutions at several residues within the ATP binding motifs that in other kinases have been shown to be required for catalysis. In vitro assays indicate the protein lacks phosphorylation activity. The protein, however, likely retains its substrate binding capability. This gene is widely expressed in human tissues and its protein localizes to the nucleus. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display impaired social behavior, decreased fear and anxiety relate behavior, impaired spatial memory, and abnormal hippocampal dendritic spine and synapse morphologies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Vrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Vrk3 APN 7 44769647 missense probably damaging 1.00
IGL01540:Vrk3 APN 7 44767144 missense probably damaging 1.00
IGL02682:Vrk3 APN 7 44753820 missense probably benign 0.19
R0462:Vrk3 UTSW 7 44764200 missense possibly damaging 0.77
R0831:Vrk3 UTSW 7 44764803 missense probably damaging 1.00
R1760:Vrk3 UTSW 7 44768471 missense probably damaging 0.98
R2212:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R2289:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R2915:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3027:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3028:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3416:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3417:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3613:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3877:Vrk3 UTSW 7 44763036 unclassified probably null
R4357:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4359:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4379:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4381:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4439:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4441:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4773:Vrk3 UTSW 7 44775476 missense probably benign
R5808:Vrk3 UTSW 7 44759874 missense probably damaging 0.96
R6180:Vrk3 UTSW 7 44769611 missense possibly damaging 0.50
R7007:Vrk3 UTSW 7 44757763 missense probably damaging 0.97
R7058:Vrk3 UTSW 7 44768466 missense probably damaging 0.98
R7425:Vrk3 UTSW 7 44770924 critical splice donor site probably null
R7995:Vrk3 UTSW 7 44764161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAAAGATTCTGCTCTGTG -3'
(R):5'- CCCTGAACTTGCTGTACTTGG -3'

Sequencing Primer
(F):5'- CAAAGATTCTGCTCTGTGGGAAGTC -3'
(R):5'- GTACTTGGGTATCGTATTCCATCCG -3'
Posted On2016-07-22