Mutagenetix > Incidental Mutation

Incidental Mutation 'R5222:Smarca4'

402367

Institutional Source

Beutler Lab

Gene Symbol

Smarca4

Ensembl Gene

ENSMUSG00000032187

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

Synonyms

SNF2beta, SW1/SNF, b2b508.1Clo, Brg1, b2b692Clo

MMRRC Submission

042795-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5222 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21616169-21704230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21655706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 694 (D694G)

Ref Sequence

ENSEMBL: ENSMUSP00000133922 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]

AlphaFold

Q3TKT4

Predicted Effect

probably benign
Transcript: ENSMUST00000034707
AA Change: D694G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: D694G

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1533	4.19e-42	SMART
low complexity region	1534	1557	N/A	INTRINSIC
low complexity region	1578	1588	N/A	INTRINSIC
low complexity region	1594	1614	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098948
AA Change: D694G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: D694G

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1363	1388	N/A	INTRINSIC
low complexity region	1391	1401	N/A	INTRINSIC
BROMO	1425	1536	4.19e-42	SMART
low complexity region	1537	1560	N/A	INTRINSIC
low complexity region	1581	1591	N/A	INTRINSIC
low complexity region	1597	1617	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000172996
AA Change: D498G

SMART Domains

Protein: ENSMUSP00000133535
Gene: ENSMUSG00000032187
AA Change: D498G

Domain	Start	End	E-Value	Type
low complexity region	26	52	N/A	INTRINSIC
low complexity region	57	94	N/A	INTRINSIC
low complexity region	109	135	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
HSA	265	337	2e-27	SMART
coiled coil region	367	399	N/A	INTRINSIC
BRK	417	461	5.17e-21	SMART
low complexity region	462	477	N/A	INTRINSIC
low complexity region	496	507	N/A	INTRINSIC
DEXDc	555	747	5.17e-38	SMART
Blast:DEXDc	758	790	6e-10	BLAST
low complexity region	824	839	N/A	INTRINSIC
HELICc	915	999	7.27e-24	SMART
low complexity region	1088	1105	N/A	INTRINSIC
SnAC	1126	1194	2.8e-29	SMART
low complexity region	1201	1226	N/A	INTRINSIC
low complexity region	1229	1239	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174008
AA Change: D694G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: D694G

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1532	1.36e-41	SMART
low complexity region	1533	1556	N/A	INTRINSIC
low complexity region	1577	1587	N/A	INTRINSIC
low complexity region	1593	1613	N/A	INTRINSIC

Meta Mutation Damage Score

0.1005

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	C	A	1: 160,044,608		noncoding transcript	Het
Acad11	G	A	9: 104,097,377	A515T	probably damaging	Het
Angpt1	T	C	15: 42,676,334	Y43C	probably damaging	Het
Arhgef33	A	G	17: 80,337,314	Y24C	probably damaging	Het
Cd40	G	C	2: 165,066,544	S180T	probably benign	Het
Cenpc1	A	T	5: 86,037,747	S302T	possibly damaging	Het
Cit	C	A	5: 115,952,543	T932K	probably benign	Het
Col19a1	A	C	1: 24,559,640		probably null	Het
Dapk3	A	G	10: 81,192,460	E288G	probably damaging	Het
Ddx60	T	C	8: 61,984,158	F1002S	probably damaging	Het
Dgke	G	T	11: 89,050,394	T321K	probably benign	Het
Ebf2	T	G	14: 67,313,594		probably benign	Het
Enpp7	A	G	11: 118,990,962	D311G	probably benign	Het
Epm2a	A	G	10: 11,448,749	E194G	probably damaging	Het
Esf1	A	G	2: 140,158,583	Y428H	possibly damaging	Het
Esyt2	T	C	12: 116,318,826	F132S	probably damaging	Het
Gm13101	T	A	4: 143,964,792	I454F	possibly damaging	Het
Gm5455	T	C	13: 110,304,960		noncoding transcript	Het
Gria1	T	A	11: 57,189,797	V202E	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Mark1	A	T	1: 184,928,091	F123I	probably damaging	Het
Nectin4	T	A	1: 171,385,257		probably null	Het
Obscn	T	A	11: 59,044,145	T5220S	possibly damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1370	T	A	13: 21,072,569	H244L	probably damaging	Het
Olfr166	A	C	16: 19,486,930	I31L	probably benign	Het
Pdcd1	A	T	1: 94,052,450	V14E	probably damaging	Het
Pmel	A	G	10: 128,718,984		probably null	Het
Prrx1	C	T	1: 163,261,973	R95Q	probably damaging	Het
Pstpip2	T	A	18: 77,874,332	Y267*	probably null	Het
Ptprq	A	G	10: 107,662,564	I884T	probably damaging	Het
Rad17	G	A	13: 100,633,891	T216I	possibly damaging	Het
Rif1	T	C	2: 52,077,020	I107T	probably benign	Het
Rpp14	T	C	14: 8,087,513	L69P	probably damaging	Het
Rtel1	G	T	2: 181,346,983		probably benign	Het
Sap130	C	T	18: 31,666,703	T362M	probably damaging	Het
Scn11a	A	G	9: 119,815,202		probably null	Het
Sec31a	G	T	5: 100,382,895	T243N	probably benign	Het
Slc5a9	T	A	4: 111,898,611	H30L	possibly damaging	Het
Slco6b1	T	A	1: 96,997,491		noncoding transcript	Het
Spaca6	A	G	17: 17,838,105	T213A	probably benign	Het
Tagap	C	A	17: 7,933,641	Q553K	possibly damaging	Het
Tagap	A	T	17: 7,933,642	Q553L	possibly damaging	Het
Tcf7l2	A	G	19: 55,898,612	Q19R	probably benign	Het
Ttn	A	G	2: 76,878,853		probably benign	Het
Ubr7	A	T	12: 102,775,705	R399S	probably benign	Het
Uspl1	C	A	5: 149,214,101	Q690K	possibly damaging	Het
Vps8	T	A	16: 21,581,548	Y853*	probably null	Het
Vrk3	A	T	7: 44,759,796	Q129L	possibly damaging	Het
Wapl	T	A	14: 34,736,685	C901*	probably null	Het

Other mutations in Smarca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Smarca4	APN	9	21679073	missense	probably benign	0.30
IGL01694:Smarca4	APN	9	21665870	missense	probably damaging	1.00
IGL02147:Smarca4	APN	9	21635703	missense	probably damaging	0.98
IGL02417:Smarca4	APN	9	21701090	missense	probably damaging	1.00
IGL02421:Smarca4	APN	9	21639239	missense	probably damaging	1.00
IGL02550:Smarca4	APN	9	21686122	missense	probably benign	0.25
IGL02794:Smarca4	APN	9	21673342	splice site	probably benign
IGL03030:Smarca4	APN	9	21635836	missense	probably benign	0.14
IGL03037:Smarca4	APN	9	21632935	unclassified	probably benign
IGL03069:Smarca4	APN	9	21635836	missense	probably benign	0.14
IGL03355:Smarca4	APN	9	21635836	missense	probably benign	0.14
R0123:Smarca4	UTSW	9	21637324	missense	probably damaging	1.00
R0134:Smarca4	UTSW	9	21637324	missense	probably damaging	1.00
R0230:Smarca4	UTSW	9	21700872	missense	probably damaging	0.99
R0269:Smarca4	UTSW	9	21636201	missense	probably benign	0.09
R0631:Smarca4	UTSW	9	21658984	splice site	probably benign
R0665:Smarca4	UTSW	9	21700943	small deletion	probably benign
R0726:Smarca4	UTSW	9	21700139	critical splice donor site	probably null
R0801:Smarca4	UTSW	9	21642554	missense	possibly damaging	0.81
R0918:Smarca4	UTSW	9	21636215	missense	probably benign	0.16
R1411:Smarca4	UTSW	9	21658955	missense	probably damaging	1.00
R1604:Smarca4	UTSW	9	21700943	small deletion	probably benign
R1768:Smarca4	UTSW	9	21701183	missense	possibly damaging	0.56
R2004:Smarca4	UTSW	9	21677480	missense	probably damaging	1.00
R2031:Smarca4	UTSW	9	21686062	missense	possibly damaging	0.68
R2211:Smarca4	UTSW	9	21686029	missense	probably damaging	1.00
R2512:Smarca4	UTSW	9	21635698	missense	possibly damaging	0.95
R2875:Smarca4	UTSW	9	21642580	missense	possibly damaging	0.55
R3786:Smarca4	UTSW	9	21672059	missense	possibly damaging	0.94
R4829:Smarca4	UTSW	9	21639327	missense	probably damaging	0.97
R5084:Smarca4	UTSW	9	21660763	missense	probably damaging	1.00
R5785:Smarca4	UTSW	9	21686026	missense	probably damaging	0.99
R5844:Smarca4	UTSW	9	21677942	intron	probably benign
R5964:Smarca4	UTSW	9	21647430	missense	probably benign	0.00
R6001:Smarca4	UTSW	9	21632909	unclassified	probably benign
R6072:Smarca4	UTSW	9	21700121	missense	probably damaging	1.00
R6254:Smarca4	UTSW	9	21699877	missense	probably damaging	1.00
R6320:Smarca4	UTSW	9	21637375	missense	probably damaging	1.00
R6353:Smarca4	UTSW	9	21679149	critical splice donor site	probably null
R6461:Smarca4	UTSW	9	21679020	missense	probably damaging	1.00
R6886:Smarca4	UTSW	9	21658831	missense	probably damaging	1.00
R7098:Smarca4	UTSW	9	21634820	missense	probably benign	0.10
R7253:Smarca4	UTSW	9	21658960	missense	probably benign	0.01
R7307:Smarca4	UTSW	9	21638800	missense	probably damaging	1.00
R7382:Smarca4	UTSW	9	21658933	missense	probably damaging	0.98
R7445:Smarca4	UTSW	9	21686247	missense	probably damaging	1.00
R7535:Smarca4	UTSW	9	21647625	missense	possibly damaging	0.82
R7573:Smarca4	UTSW	9	21639075	splice site	probably null
R7644:Smarca4	UTSW	9	21655654	missense	probably benign	0.00
R7734:Smarca4	UTSW	9	21667362	missense	possibly damaging	0.65
R7833:Smarca4	UTSW	9	21647359	missense	possibly damaging	0.86
R8085:Smarca4	UTSW	9	21658812	splice site	probably null
R8119:Smarca4	UTSW	9	21647626	missense	possibly damaging	0.61
R8320:Smarca4	UTSW	9	21677502	missense	probably benign	0.10
R8445:Smarca4	UTSW	9	21700943	small deletion	probably benign
R8493:Smarca4	UTSW	9	21658848	missense	probably damaging	1.00
R8748:Smarca4	UTSW	9	21634868	missense	possibly damaging	0.85
R8788:Smarca4	UTSW	9	21638728	missense	probably damaging	1.00
R8817:Smarca4	UTSW	9	21636201	missense	probably benign	0.04
R9241:Smarca4	UTSW	9	21639308	missense	possibly damaging	0.72
R9446:Smarca4	UTSW	9	21635859	missense	unknown
R9570:Smarca4	UTSW	9	21669553	missense	probably damaging	1.00
R9727:Smarca4	UTSW	9	21699864	missense	probably damaging	1.00
R9801:Smarca4	UTSW	9	21675101	missense	probably damaging	1.00
Z1176:Smarca4	UTSW	9	21702957	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCAGCAATTCAATGGGAAGG -3'
(R):5'- TGTAGGAAACAAATGTGGCCC -3'

Sequencing Primer
(F):5'- CAATTCAATGGGAAGGGCAGG -3'
(R):5'- ACAAATGTGGCCCTTCAGTG -3'

Posted On

2016-07-22