Incidental Mutation 'R5222:Epm2a'
ID402370
Institutional Source Beutler Lab
Gene Symbol Epm2a
Ensembl Gene ENSMUSG00000055493
Gene Nameepilepsy, progressive myoclonic epilepsy, type 2 gene alpha
SynonymsTG-B, laforin, Tg(TcraK,TcrbK)TG-BFlv
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location11343404-11459644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11448749 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 194 (E194G)
Ref Sequence ENSEMBL: ENSMUSP00000066050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069106]
Predicted Effect probably damaging
Transcript: ENSMUST00000069106
AA Change: E194G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066050
Gene: ENSMUSG00000055493
AA Change: E194G

DomainStartEndE-ValueType
CBM_2 4 115 4.89e-14 SMART
Pfam:DSPc 163 314 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161438
Meta Mutation Damage Score 0.6390 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual-specificity phosphatase that associates with polyribosomes. The encoded protein may be involved in the regulation of glycogen metabolism. Mutations in this gene have been associated with myoclonic epilepsy of Lafora. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit behavioral deficits, ataxia, myoclonus epilepsy, and widespread degeneration of neurons in the presence of only a few small Lafora inclusions, providing a putative mouse model of human Lafora disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Epm2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Epm2a APN 10 11448640 critical splice acceptor site probably null
IGL01925:Epm2a APN 10 11448758 missense possibly damaging 0.93
IGL02612:Epm2a APN 10 11457236 missense probably damaging 1.00
IGL03052:Epm2a UTSW 10 11457230 missense possibly damaging 0.95
R1432:Epm2a UTSW 10 11390843 missense probably damaging 0.99
R1716:Epm2a UTSW 10 11448836 missense probably benign 0.31
R1785:Epm2a UTSW 10 11343682 missense probably benign
R2132:Epm2a UTSW 10 11343682 missense probably benign
R2133:Epm2a UTSW 10 11343682 missense probably benign
R3715:Epm2a UTSW 10 11343676 missense probably benign 0.01
R4794:Epm2a UTSW 10 11390853 missense probably benign 0.01
R5254:Epm2a UTSW 10 11457345 missense probably benign 0.00
R6608:Epm2a UTSW 10 11390987 critical splice donor site probably null
R6941:Epm2a UTSW 10 11391085 intron probably null
R7211:Epm2a UTSW 10 11343675 missense probably benign 0.00
R7440:Epm2a UTSW 10 11390875 nonsense probably null
R7740:Epm2a UTSW 10 11390940 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AATCCAGCCTTATCAGATTGGAAG -3'
(R):5'- AGCAAATTCAGCAAGGAATCCG -3'

Sequencing Primer
(F):5'- GCCTTATCAGATTGGAAGATGAATTG -3'
(R):5'- CAAGGAATCCGAGTGCTACTTCTG -3'
Posted On2016-07-22