Incidental Mutation 'R5222:Epm2a'
ID 402370
Institutional Source Beutler Lab
Gene Symbol Epm2a
Ensembl Gene ENSMUSG00000055493
Gene Name epilepsy, progressive myoclonic epilepsy, type 2 gene alpha
Synonyms laforin
MMRRC Submission 042795-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R5222 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 11219148-11335388 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11324493 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 194 (E194G)
Ref Sequence ENSEMBL: ENSMUSP00000066050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069106]
AlphaFold Q9WUA5
Predicted Effect probably damaging
Transcript: ENSMUST00000069106
AA Change: E194G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066050
Gene: ENSMUSG00000055493
AA Change: E194G

DomainStartEndE-ValueType
CBM_2 4 115 4.89e-14 SMART
Pfam:DSPc 163 314 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161438
Meta Mutation Damage Score 0.6390 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual-specificity phosphatase that associates with polyribosomes. The encoded protein may be involved in the regulation of glycogen metabolism. Mutations in this gene have been associated with myoclonic epilepsy of Lafora. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit behavioral deficits, ataxia, myoclonus epilepsy, and widespread degeneration of neurons in the presence of only a few small Lafora inclusions, providing a putative mouse model of human Lafora disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 159,872,178 (GRCm39) noncoding transcript Het
Acad11 G A 9: 103,974,576 (GRCm39) A515T probably damaging Het
Angpt1 T C 15: 42,539,730 (GRCm39) Y43C probably damaging Het
Arhgef33 A G 17: 80,644,743 (GRCm39) Y24C probably damaging Het
Cd40 G C 2: 164,908,464 (GRCm39) S180T probably benign Het
Cenpc1 A T 5: 86,185,606 (GRCm39) S302T possibly damaging Het
Cit C A 5: 116,090,602 (GRCm39) T932K probably benign Het
Col19a1 A C 1: 24,598,721 (GRCm39) probably null Het
Dapk3 A G 10: 81,028,294 (GRCm39) E288G probably damaging Het
Ddx60 T C 8: 62,437,192 (GRCm39) F1002S probably damaging Het
Dgke G T 11: 88,941,220 (GRCm39) T321K probably benign Het
Ebf2 T G 14: 67,551,043 (GRCm39) probably benign Het
Enpp7 A G 11: 118,881,788 (GRCm39) D311G probably benign Het
Esf1 A G 2: 140,000,503 (GRCm39) Y428H possibly damaging Het
Esyt2 T C 12: 116,282,446 (GRCm39) F132S probably damaging Het
Gm5455 T C 13: 110,441,494 (GRCm39) noncoding transcript Het
Gria1 T A 11: 57,080,623 (GRCm39) V202E probably benign Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Mark1 A T 1: 184,660,288 (GRCm39) F123I probably damaging Het
Nectin4 T A 1: 171,212,825 (GRCm39) probably null Het
Obscn T A 11: 58,934,971 (GRCm39) T5220S possibly damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2l13 A C 16: 19,305,680 (GRCm39) I31L probably benign Het
Or2p2 T A 13: 21,256,739 (GRCm39) H244L probably damaging Het
Pdcd1 A T 1: 93,980,175 (GRCm39) V14E probably damaging Het
Pmel A G 10: 128,554,853 (GRCm39) probably null Het
Pramel28 T A 4: 143,691,362 (GRCm39) I454F possibly damaging Het
Prrx1 C T 1: 163,089,542 (GRCm39) R95Q probably damaging Het
Pstpip2 T A 18: 77,962,032 (GRCm39) Y267* probably null Het
Ptprq A G 10: 107,498,425 (GRCm39) I884T probably damaging Het
Rad17 G A 13: 100,770,399 (GRCm39) T216I possibly damaging Het
Rif1 T C 2: 51,967,032 (GRCm39) I107T probably benign Het
Rpp14 T C 14: 8,087,513 (GRCm38) L69P probably damaging Het
Rtel1 G T 2: 180,988,776 (GRCm39) probably benign Het
Sap130 C T 18: 31,799,756 (GRCm39) T362M probably damaging Het
Scn11a A G 9: 119,644,268 (GRCm39) probably null Het
Sec31a G T 5: 100,530,754 (GRCm39) T243N probably benign Het
Slc5a9 T A 4: 111,755,808 (GRCm39) H30L possibly damaging Het
Slco6b1 T A 1: 96,925,216 (GRCm39) noncoding transcript Het
Smarca4 A G 9: 21,567,002 (GRCm39) D694G probably benign Het
Spaca6 A G 17: 18,058,367 (GRCm39) T213A probably benign Het
Tagap C A 17: 8,152,473 (GRCm39) Q553K possibly damaging Het
Tagap A T 17: 8,152,474 (GRCm39) Q553L possibly damaging Het
Tcf7l2 A G 19: 55,887,044 (GRCm39) Q19R probably benign Het
Ttn A G 2: 76,709,197 (GRCm39) probably benign Het
Ubr7 A T 12: 102,741,964 (GRCm39) R399S probably benign Het
Uspl1 C A 5: 149,150,911 (GRCm39) Q690K possibly damaging Het
Vps8 T A 16: 21,400,298 (GRCm39) Y853* probably null Het
Vrk3 A T 7: 44,409,220 (GRCm39) Q129L possibly damaging Het
Wapl T A 14: 34,458,642 (GRCm39) C901* probably null Het
Other mutations in Epm2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Epm2a APN 10 11,324,384 (GRCm39) critical splice acceptor site probably null
IGL01925:Epm2a APN 10 11,324,502 (GRCm39) missense possibly damaging 0.93
IGL02612:Epm2a APN 10 11,332,980 (GRCm39) missense probably damaging 1.00
IGL03052:Epm2a UTSW 10 11,332,974 (GRCm39) missense possibly damaging 0.95
R1432:Epm2a UTSW 10 11,266,587 (GRCm39) missense probably damaging 0.99
R1716:Epm2a UTSW 10 11,324,580 (GRCm39) missense probably benign 0.31
R1785:Epm2a UTSW 10 11,219,426 (GRCm39) missense probably benign
R2132:Epm2a UTSW 10 11,219,426 (GRCm39) missense probably benign
R2133:Epm2a UTSW 10 11,219,426 (GRCm39) missense probably benign
R3715:Epm2a UTSW 10 11,219,420 (GRCm39) missense probably benign 0.01
R4794:Epm2a UTSW 10 11,266,597 (GRCm39) missense probably benign 0.01
R5254:Epm2a UTSW 10 11,333,089 (GRCm39) missense probably benign 0.00
R6608:Epm2a UTSW 10 11,266,731 (GRCm39) critical splice donor site probably null
R6941:Epm2a UTSW 10 11,266,829 (GRCm39) splice site probably null
R7211:Epm2a UTSW 10 11,219,419 (GRCm39) missense probably benign 0.00
R7440:Epm2a UTSW 10 11,266,619 (GRCm39) nonsense probably null
R7740:Epm2a UTSW 10 11,266,684 (GRCm39) missense possibly damaging 0.73
R9447:Epm2a UTSW 10 11,324,432 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AATCCAGCCTTATCAGATTGGAAG -3'
(R):5'- AGCAAATTCAGCAAGGAATCCG -3'

Sequencing Primer
(F):5'- GCCTTATCAGATTGGAAGATGAATTG -3'
(R):5'- CAAGGAATCCGAGTGCTACTTCTG -3'
Posted On 2016-07-22