Incidental Mutation 'R5222:Ptprq'
ID 402372
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Name protein tyrosine phosphatase, receptor type, Q
Synonyms
MMRRC Submission 042795-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R5222 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 107517049-107720051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107662564 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 884 (I884T)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
AlphaFold P0C5E4
Predicted Effect probably damaging
Transcript: ENSMUST00000050702
AA Change: I884T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: I884T

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218399
Meta Mutation Damage Score 0.1911 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107576929 missense probably damaging 0.98
IGL00537:Ptprq APN 10 107710522 missense probably benign 0.07
IGL00547:Ptprq APN 10 107718541 missense probably damaging 0.99
IGL00586:Ptprq APN 10 107608122 splice site probably benign
IGL00648:Ptprq APN 10 107646716 missense probably benign 0.10
IGL01123:Ptprq APN 10 107686218 missense probably damaging 0.96
IGL01343:Ptprq APN 10 107638839 missense probably damaging 0.96
IGL01348:Ptprq APN 10 107711904 missense probably damaging 1.00
IGL01433:Ptprq APN 10 107576880 missense probably damaging 0.99
IGL01510:Ptprq APN 10 107712048 missense probably damaging 1.00
IGL01535:Ptprq APN 10 107699596 missense probably benign
IGL01631:Ptprq APN 10 107643538 missense probably benign 0.00
IGL01633:Ptprq APN 10 107699723 splice site probably benign
IGL01702:Ptprq APN 10 107517866 missense probably benign 0.00
IGL01733:Ptprq APN 10 107662599 missense probably benign 0.10
IGL01806:Ptprq APN 10 107699608 missense probably damaging 1.00
IGL01832:Ptprq APN 10 107565839 critical splice donor site probably null
IGL01961:Ptprq APN 10 107643654 missense probably damaging 1.00
IGL02108:Ptprq APN 10 107646617 missense probably damaging 1.00
IGL02120:Ptprq APN 10 107667472 missense probably damaging 1.00
IGL02160:Ptprq APN 10 107653565 missense probably benign 0.00
IGL02178:Ptprq APN 10 107686319 missense probably benign 0.03
IGL02249:Ptprq APN 10 107582359 missense probably damaging 1.00
IGL02267:Ptprq APN 10 107646558 missense probably damaging 1.00
IGL02527:Ptprq APN 10 107686563 missense probably benign 0.04
IGL02529:Ptprq APN 10 107635365 missense probably benign 0.03
IGL02542:Ptprq APN 10 107662555 missense probably damaging 1.00
IGL02582:Ptprq APN 10 107643999 missense probably benign 0.00
IGL02708:Ptprq APN 10 107652700 missense probably damaging 1.00
IGL02894:Ptprq APN 10 107667424 missense probably benign
IGL02903:Ptprq APN 10 107666586 missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107667460 missense probably benign 0.03
IGL02982:Ptprq APN 10 107586684 missense probably damaging 1.00
IGL03000:Ptprq APN 10 107542657 missense probably damaging 1.00
IGL03024:Ptprq APN 10 107685566 missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107688507 missense probably benign
P0043:Ptprq UTSW 10 107580225 missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107666567 missense probably damaging 1.00
R0200:Ptprq UTSW 10 107685157 missense probably benign
R0268:Ptprq UTSW 10 107705548 missense probably benign
R0276:Ptprq UTSW 10 107542735 critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107608417 missense probably damaging 0.96
R0335:Ptprq UTSW 10 107708728 missense probably benign
R0344:Ptprq UTSW 10 107705582 missense probably benign
R0357:Ptprq UTSW 10 107686199 splice site probably benign
R0454:Ptprq UTSW 10 107582530 nonsense probably null
R0479:Ptprq UTSW 10 107643994 nonsense probably null
R0491:Ptprq UTSW 10 107608175 missense probably damaging 0.98
R0519:Ptprq UTSW 10 107538920 splice site probably benign
R0523:Ptprq UTSW 10 107580220 missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107710627 missense probably benign 0.33
R0746:Ptprq UTSW 10 107517831 missense probably damaging 1.00
R0755:Ptprq UTSW 10 107582539 missense probably benign 0.09
R1434:Ptprq UTSW 10 107586714 missense probably damaging 1.00
R1445:Ptprq UTSW 10 107662562 missense probably damaging 1.00
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1558:Ptprq UTSW 10 107644043 missense probably damaging 1.00
R1567:Ptprq UTSW 10 107565887 missense probably benign 0.13
R1711:Ptprq UTSW 10 107534699 nonsense probably null
R1720:Ptprq UTSW 10 107686294 missense probably damaging 1.00
R1746:Ptprq UTSW 10 107638830 missense probably damaging 1.00
R1776:Ptprq UTSW 10 107685089 missense probably damaging 1.00
R1822:Ptprq UTSW 10 107718478 missense probably damaging 1.00
R1872:Ptprq UTSW 10 107643999 missense probably benign 0.19
R1944:Ptprq UTSW 10 107582388 missense probably benign 0.23
R1945:Ptprq UTSW 10 107582388 missense probably benign 0.23
R2006:Ptprq UTSW 10 107666546 missense probably damaging 1.00
R2014:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2015:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2097:Ptprq UTSW 10 107653493 missense probably benign 0.05
R2172:Ptprq UTSW 10 107590994 nonsense probably null
R2174:Ptprq UTSW 10 107705553 missense probably damaging 1.00
R2248:Ptprq UTSW 10 107643070 splice site probably null
R2404:Ptprq UTSW 10 107686599 missense probably damaging 1.00
R3423:Ptprq UTSW 10 107582476 missense probably damaging 0.99
R3683:Ptprq UTSW 10 107708628 missense probably benign 0.01
R3875:Ptprq UTSW 10 107685104 missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107686392 splice site probably benign
R3946:Ptprq UTSW 10 107686392 splice site probably benign
R3974:Ptprq UTSW 10 107712062 missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107543396 missense probably damaging 0.99
R4105:Ptprq UTSW 10 107572967 missense probably damaging 1.00
R4118:Ptprq UTSW 10 107711920 missense probably benign 0.37
R4175:Ptprq UTSW 10 107711917 missense probably benign
R4231:Ptprq UTSW 10 107686283 nonsense probably null
R4356:Ptprq UTSW 10 107608364 missense probably damaging 0.99
R4435:Ptprq UTSW 10 107685055 missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4679:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4745:Ptprq UTSW 10 107524253 missense probably damaging 1.00
R4771:Ptprq UTSW 10 107688427 missense probably benign
R4778:Ptprq UTSW 10 107591022 missense probably benign 0.15
R4808:Ptprq UTSW 10 107718507 missense probably damaging 1.00
R4809:Ptprq UTSW 10 107563175 missense probably damaging 1.00
R4818:Ptprq UTSW 10 107710581 missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107653532 missense probably benign 0.00
R4901:Ptprq UTSW 10 107688414 missense probably benign 0.01
R4942:Ptprq UTSW 10 107688429 missense probably benign 0.01
R4946:Ptprq UTSW 10 107525734 missense probably benign
R4959:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R4973:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R5007:Ptprq UTSW 10 107608276 missense probably benign 0.00
R5053:Ptprq UTSW 10 107563202 missense probably damaging 1.00
R5055:Ptprq UTSW 10 107534679 missense probably benign 0.37
R5090:Ptprq UTSW 10 107526089 missense probably damaging 1.00
R5158:Ptprq UTSW 10 107534704 missense probably damaging 1.00
R5163:Ptprq UTSW 10 107524331 missense probably damaging 1.00
R5244:Ptprq UTSW 10 107586695 missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107699635 missense probably damaging 0.99
R5503:Ptprq UTSW 10 107688328 splice site probably null
R5508:Ptprq UTSW 10 107686231 missense probably benign 0.00
R5601:Ptprq UTSW 10 107608430 missense probably benign
R5722:Ptprq UTSW 10 107686365 missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107719883 start gained probably benign
R5862:Ptprq UTSW 10 107565878 missense probably benign 0.02
R5891:Ptprq UTSW 10 107576895 missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107523513 missense probably damaging 1.00
R6054:Ptprq UTSW 10 107582358 missense probably damaging 1.00
R6058:Ptprq UTSW 10 107635274 missense probably benign 0.00
R6075:Ptprq UTSW 10 107525760 missense probably damaging 1.00
R6101:Ptprq UTSW 10 107580266 missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107517887 missense probably damaging 1.00
R6235:Ptprq UTSW 10 107635338 missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107708668 missense probably damaging 0.99
R6394:Ptprq UTSW 10 107642943 nonsense probably null
R6449:Ptprq UTSW 10 107705583 missense probably benign 0.00
R6526:Ptprq UTSW 10 107542653 nonsense probably null
R6544:Ptprq UTSW 10 107608241 missense probably damaging 1.00
R6609:Ptprq UTSW 10 107572968 missense probably damaging 0.99
R6862:Ptprq UTSW 10 107686225 missense probably damaging 0.96
R6874:Ptprq UTSW 10 107718599 missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107576004 missense probably benign 0.00
R7082:Ptprq UTSW 10 107708730 missense probably benign 0.10
R7210:Ptprq UTSW 10 107685171 missense probably damaging 1.00
R7253:Ptprq UTSW 10 107608273 missense probably benign 0.30
R7293:Ptprq UTSW 10 107635506 nonsense probably null
R7445:Ptprq UTSW 10 107590959 missense probably damaging 1.00
R7632:Ptprq UTSW 10 107711922 missense probably benign 0.32
R7685:Ptprq UTSW 10 107643978 missense probably damaging 1.00
R7703:Ptprq UTSW 10 107644146 missense probably benign 0.01
R7774:Ptprq UTSW 10 107643669 missense probably damaging 0.96
R7897:Ptprq UTSW 10 107710623 missense probably benign 0.21
R7936:Ptprq UTSW 10 107652711 missense probably damaging 1.00
R7983:Ptprq UTSW 10 107608411 nonsense probably null
R8023:Ptprq UTSW 10 107652616 nonsense probably null
R8071:Ptprq UTSW 10 107644035 missense possibly damaging 0.62
R8084:Ptprq UTSW 10 107608433 missense probably benign
R8086:Ptprq UTSW 10 107646639 nonsense probably null
R8169:Ptprq UTSW 10 107582490 missense probably damaging 1.00
R8223:Ptprq UTSW 10 107699638 missense probably benign 0.00
R8235:Ptprq UTSW 10 107582541 missense probably damaging 1.00
R8235:Ptprq UTSW 10 107705490 missense probably benign 0.32
R8278:Ptprq UTSW 10 107686378 missense possibly damaging 0.87
R8710:Ptprq UTSW 10 107576058 missense possibly damaging 0.67
R8828:Ptprq UTSW 10 107646652 missense probably benign
R8830:Ptprq UTSW 10 107586695 missense possibly damaging 0.62
R8869:Ptprq UTSW 10 107699608 missense probably damaging 1.00
R9012:Ptprq UTSW 10 107653550 missense probably benign 0.09
R9072:Ptprq UTSW 10 107565875 missense
R9153:Ptprq UTSW 10 107580265 missense probably damaging 0.98
R9202:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R9252:Ptprq UTSW 10 107686386 missense probably benign 0.12
R9306:Ptprq UTSW 10 107586738 missense probably benign 0.00
R9492:Ptprq UTSW 10 107642952 missense probably damaging 1.00
R9519:Ptprq UTSW 10 107685100 missense probably damaging 1.00
R9581:Ptprq UTSW 10 107711910 missense possibly damaging 0.53
R9593:Ptprq UTSW 10 107688393 missense possibly damaging 0.92
R9621:Ptprq UTSW 10 107542662 missense probably damaging 1.00
R9732:Ptprq UTSW 10 107576906 missense probably damaging 1.00
R9743:Ptprq UTSW 10 107685121 missense probably damaging 1.00
R9771:Ptprq UTSW 10 107685224 missense probably damaging 0.99
R9788:Ptprq UTSW 10 107565890 missense probably benign 0.24
Z1088:Ptprq UTSW 10 107699672 missense possibly damaging 0.56
Z1176:Ptprq UTSW 10 107526070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGACCAACTGCATAATATG -3'
(R):5'- TATGGAGAGAAGTGCTGAACATGATTC -3'

Sequencing Primer
(F):5'- GACCAACTGCATAATATGATGAAAAC -3'
(R):5'- GTGCTGAACATGATTCATTTAACAC -3'
Posted On 2016-07-22