Mutagenetix > Incidental Mutation

Incidental Mutation 'R5222:Ptprq'

402372

Institutional Source

Beutler Lab

Gene Symbol

Ptprq

Ensembl Gene

ENSMUSG00000035916

Gene Name

protein tyrosine phosphatase, receptor type, Q

Synonyms

MMRRC Submission

042795-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.181) question?

Stock #

R5222 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107517049-107720051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107662564 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 884 (I884T)

Ref Sequence

ENSEMBL: ENSMUSP00000058572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050702]

AlphaFold

P0C5E4

Predicted Effect

probably damaging
Transcript: ENSMUST00000050702
AA Change: I884T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: I884T

Domain	Start	End	E-Value	Type
FN3	57	141	3.17e-13	SMART
FN3	156	294	1.55e-7	SMART
FN3	307	384	4.45e-8	SMART
FN3	398	555	1.17e-7	SMART
FN3	569	648	7.06e-11	SMART
FN3	666	743	7.68e-12	SMART
FN3	760	839	1.88e-6	SMART
FN3	855	932	1.33e-6	SMART
FN3	949	1037	2.31e-6	SMART
FN3	1054	1135	1.24e-6	SMART
FN3	1151	1229	2.39e-8	SMART
FN3	1244	1325	6.29e-8	SMART
FN3	1341	1416	2.87e-11	SMART
FN3	1431	1524	2.82e-10	SMART
FN3	1540	1622	6.35e-4	SMART
FN3	1642	1732	7.93e-5	SMART
transmembrane domain	1907	1929	N/A	INTRINSIC
PTPc	2003	2262	1.14e-130	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218399

Meta Mutation Damage Score

0.1911

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	C	A	1: 160,044,608		noncoding transcript	Het
Acad11	G	A	9: 104,097,377	A515T	probably damaging	Het
Angpt1	T	C	15: 42,676,334	Y43C	probably damaging	Het
Arhgef33	A	G	17: 80,337,314	Y24C	probably damaging	Het
Cd40	G	C	2: 165,066,544	S180T	probably benign	Het
Cenpc1	A	T	5: 86,037,747	S302T	possibly damaging	Het
Cit	C	A	5: 115,952,543	T932K	probably benign	Het
Col19a1	A	C	1: 24,559,640		probably null	Het
Dapk3	A	G	10: 81,192,460	E288G	probably damaging	Het
Ddx60	T	C	8: 61,984,158	F1002S	probably damaging	Het
Dgke	G	T	11: 89,050,394	T321K	probably benign	Het
Ebf2	T	G	14: 67,313,594		probably benign	Het
Enpp7	A	G	11: 118,990,962	D311G	probably benign	Het
Epm2a	A	G	10: 11,448,749	E194G	probably damaging	Het
Esf1	A	G	2: 140,158,583	Y428H	possibly damaging	Het
Esyt2	T	C	12: 116,318,826	F132S	probably damaging	Het
Gm13101	T	A	4: 143,964,792	I454F	possibly damaging	Het
Gm5455	T	C	13: 110,304,960		noncoding transcript	Het
Gria1	T	A	11: 57,189,797	V202E	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Mark1	A	T	1: 184,928,091	F123I	probably damaging	Het
Nectin4	T	A	1: 171,385,257		probably null	Het
Obscn	T	A	11: 59,044,145	T5220S	possibly damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1370	T	A	13: 21,072,569	H244L	probably damaging	Het
Olfr166	A	C	16: 19,486,930	I31L	probably benign	Het
Pdcd1	A	T	1: 94,052,450	V14E	probably damaging	Het
Pmel	A	G	10: 128,718,984		probably null	Het
Prrx1	C	T	1: 163,261,973	R95Q	probably damaging	Het
Pstpip2	T	A	18: 77,874,332	Y267*	probably null	Het
Rad17	G	A	13: 100,633,891	T216I	possibly damaging	Het
Rif1	T	C	2: 52,077,020	I107T	probably benign	Het
Rpp14	T	C	14: 8,087,513	L69P	probably damaging	Het
Rtel1	G	T	2: 181,346,983		probably benign	Het
Sap130	C	T	18: 31,666,703	T362M	probably damaging	Het
Scn11a	A	G	9: 119,815,202		probably null	Het
Sec31a	G	T	5: 100,382,895	T243N	probably benign	Het
Slc5a9	T	A	4: 111,898,611	H30L	possibly damaging	Het
Slco6b1	T	A	1: 96,997,491		noncoding transcript	Het
Smarca4	A	G	9: 21,655,706	D694G	probably benign	Het
Spaca6	A	G	17: 17,838,105	T213A	probably benign	Het
Tagap	C	A	17: 7,933,641	Q553K	possibly damaging	Het
Tagap	A	T	17: 7,933,642	Q553L	possibly damaging	Het
Tcf7l2	A	G	19: 55,898,612	Q19R	probably benign	Het
Ttn	A	G	2: 76,878,853		probably benign	Het
Ubr7	A	T	12: 102,775,705	R399S	probably benign	Het
Uspl1	C	A	5: 149,214,101	Q690K	possibly damaging	Het
Vps8	T	A	16: 21,581,548	Y853*	probably null	Het
Vrk3	A	T	7: 44,759,796	Q129L	possibly damaging	Het
Wapl	T	A	14: 34,736,685	C901*	probably null	Het

Other mutations in Ptprq

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ptprq	APN	10	107576929	missense	probably damaging	0.98
IGL00537:Ptprq	APN	10	107710522	missense	probably benign	0.07
IGL00547:Ptprq	APN	10	107718541	missense	probably damaging	0.99
IGL00586:Ptprq	APN	10	107608122	splice site	probably benign
IGL00648:Ptprq	APN	10	107646716	missense	probably benign	0.10
IGL01123:Ptprq	APN	10	107686218	missense	probably damaging	0.96
IGL01343:Ptprq	APN	10	107638839	missense	probably damaging	0.96
IGL01348:Ptprq	APN	10	107711904	missense	probably damaging	1.00
IGL01433:Ptprq	APN	10	107576880	missense	probably damaging	0.99
IGL01510:Ptprq	APN	10	107712048	missense	probably damaging	1.00
IGL01535:Ptprq	APN	10	107699596	missense	probably benign
IGL01631:Ptprq	APN	10	107643538	missense	probably benign	0.00
IGL01633:Ptprq	APN	10	107699723	splice site	probably benign
IGL01702:Ptprq	APN	10	107517866	missense	probably benign	0.00
IGL01733:Ptprq	APN	10	107662599	missense	probably benign	0.10
IGL01806:Ptprq	APN	10	107699608	missense	probably damaging	1.00
IGL01832:Ptprq	APN	10	107565839	critical splice donor site	probably null
IGL01961:Ptprq	APN	10	107643654	missense	probably damaging	1.00
IGL02108:Ptprq	APN	10	107646617	missense	probably damaging	1.00
IGL02120:Ptprq	APN	10	107667472	missense	probably damaging	1.00
IGL02160:Ptprq	APN	10	107653565	missense	probably benign	0.00
IGL02178:Ptprq	APN	10	107686319	missense	probably benign	0.03
IGL02249:Ptprq	APN	10	107582359	missense	probably damaging	1.00
IGL02267:Ptprq	APN	10	107646558	missense	probably damaging	1.00
IGL02527:Ptprq	APN	10	107686563	missense	probably benign	0.04
IGL02529:Ptprq	APN	10	107635365	missense	probably benign	0.03
IGL02542:Ptprq	APN	10	107662555	missense	probably damaging	1.00
IGL02582:Ptprq	APN	10	107643999	missense	probably benign	0.00
IGL02708:Ptprq	APN	10	107652700	missense	probably damaging	1.00
IGL02894:Ptprq	APN	10	107667424	missense	probably benign
IGL02903:Ptprq	APN	10	107666586	missense	possibly damaging	0.51
IGL02951:Ptprq	APN	10	107667460	missense	probably benign	0.03
IGL02982:Ptprq	APN	10	107586684	missense	probably damaging	1.00
IGL03000:Ptprq	APN	10	107542657	missense	probably damaging	1.00
IGL03024:Ptprq	APN	10	107685566	missense	possibly damaging	0.69
IGL03240:Ptprq	APN	10	107688507	missense	probably benign
P0043:Ptprq	UTSW	10	107580225	missense	probably benign	0.03
PIT4812001:Ptprq	UTSW	10	107666567	missense	probably damaging	1.00
R0200:Ptprq	UTSW	10	107685157	missense	probably benign
R0268:Ptprq	UTSW	10	107705548	missense	probably benign
R0276:Ptprq	UTSW	10	107542735	critical splice acceptor site	probably null
R0279:Ptprq	UTSW	10	107608417	missense	probably damaging	0.96
R0335:Ptprq	UTSW	10	107708728	missense	probably benign
R0344:Ptprq	UTSW	10	107705582	missense	probably benign
R0357:Ptprq	UTSW	10	107686199	splice site	probably benign
R0454:Ptprq	UTSW	10	107582530	nonsense	probably null
R0479:Ptprq	UTSW	10	107643994	nonsense	probably null
R0491:Ptprq	UTSW	10	107608175	missense	probably damaging	0.98
R0519:Ptprq	UTSW	10	107538920	splice site	probably benign
R0523:Ptprq	UTSW	10	107580220	missense	possibly damaging	0.54
R0553:Ptprq	UTSW	10	107710627	missense	probably benign	0.33
R0746:Ptprq	UTSW	10	107517831	missense	probably damaging	1.00
R0755:Ptprq	UTSW	10	107582539	missense	probably benign	0.09
R1434:Ptprq	UTSW	10	107586714	missense	probably damaging	1.00
R1445:Ptprq	UTSW	10	107662562	missense	probably damaging	1.00
R1470:Ptprq	UTSW	10	107718574	missense	probably damaging	0.97
R1470:Ptprq	UTSW	10	107718574	missense	probably damaging	0.97
R1558:Ptprq	UTSW	10	107644043	missense	probably damaging	1.00
R1567:Ptprq	UTSW	10	107565887	missense	probably benign	0.13
R1711:Ptprq	UTSW	10	107534699	nonsense	probably null
R1720:Ptprq	UTSW	10	107686294	missense	probably damaging	1.00
R1746:Ptprq	UTSW	10	107638830	missense	probably damaging	1.00
R1776:Ptprq	UTSW	10	107685089	missense	probably damaging	1.00
R1822:Ptprq	UTSW	10	107718478	missense	probably damaging	1.00
R1872:Ptprq	UTSW	10	107643999	missense	probably benign	0.19
R1944:Ptprq	UTSW	10	107582388	missense	probably benign	0.23
R1945:Ptprq	UTSW	10	107582388	missense	probably benign	0.23
R2006:Ptprq	UTSW	10	107666546	missense	probably damaging	1.00
R2014:Ptprq	UTSW	10	107667422	missense	probably damaging	0.96
R2015:Ptprq	UTSW	10	107667422	missense	probably damaging	0.96
R2097:Ptprq	UTSW	10	107653493	missense	probably benign	0.05
R2172:Ptprq	UTSW	10	107590994	nonsense	probably null
R2174:Ptprq	UTSW	10	107705553	missense	probably damaging	1.00
R2248:Ptprq	UTSW	10	107643070	splice site	probably null
R2404:Ptprq	UTSW	10	107686599	missense	probably damaging	1.00
R3423:Ptprq	UTSW	10	107582476	missense	probably damaging	0.99
R3683:Ptprq	UTSW	10	107708628	missense	probably benign	0.01
R3875:Ptprq	UTSW	10	107685104	missense	possibly damaging	0.88
R3945:Ptprq	UTSW	10	107686392	splice site	probably benign
R3946:Ptprq	UTSW	10	107686392	splice site	probably benign
R3974:Ptprq	UTSW	10	107712062	missense	possibly damaging	0.88
R3982:Ptprq	UTSW	10	107543396	missense	probably damaging	0.99
R4105:Ptprq	UTSW	10	107572967	missense	probably damaging	1.00
R4118:Ptprq	UTSW	10	107711920	missense	probably benign	0.37
R4175:Ptprq	UTSW	10	107711917	missense	probably benign
R4231:Ptprq	UTSW	10	107686283	nonsense	probably null
R4356:Ptprq	UTSW	10	107608364	missense	probably damaging	0.99
R4435:Ptprq	UTSW	10	107685055	missense	possibly damaging	0.89
R4678:Ptprq	UTSW	10	107685182	missense	probably benign	0.19
R4679:Ptprq	UTSW	10	107685182	missense	probably benign	0.19
R4745:Ptprq	UTSW	10	107524253	missense	probably damaging	1.00
R4771:Ptprq	UTSW	10	107688427	missense	probably benign
R4778:Ptprq	UTSW	10	107591022	missense	probably benign	0.15
R4808:Ptprq	UTSW	10	107718507	missense	probably damaging	1.00
R4809:Ptprq	UTSW	10	107563175	missense	probably damaging	1.00
R4818:Ptprq	UTSW	10	107710581	missense	possibly damaging	0.86
R4845:Ptprq	UTSW	10	107653532	missense	probably benign	0.00
R4901:Ptprq	UTSW	10	107688414	missense	probably benign	0.01
R4942:Ptprq	UTSW	10	107688429	missense	probably benign	0.01
R4946:Ptprq	UTSW	10	107525734	missense	probably benign
R4959:Ptprq	UTSW	10	107686555	missense	probably damaging	1.00
R4973:Ptprq	UTSW	10	107686555	missense	probably damaging	1.00
R5007:Ptprq	UTSW	10	107608276	missense	probably benign	0.00
R5053:Ptprq	UTSW	10	107563202	missense	probably damaging	1.00
R5055:Ptprq	UTSW	10	107534679	missense	probably benign	0.37
R5090:Ptprq	UTSW	10	107526089	missense	probably damaging	1.00
R5158:Ptprq	UTSW	10	107534704	missense	probably damaging	1.00
R5163:Ptprq	UTSW	10	107524331	missense	probably damaging	1.00
R5244:Ptprq	UTSW	10	107586695	missense	possibly damaging	0.62
R5249:Ptprq	UTSW	10	107699635	missense	probably damaging	0.99
R5503:Ptprq	UTSW	10	107688328	splice site	probably null
R5508:Ptprq	UTSW	10	107686231	missense	probably benign	0.00
R5601:Ptprq	UTSW	10	107608430	missense	probably benign
R5722:Ptprq	UTSW	10	107686365	missense	possibly damaging	0.72
R5819:Ptprq	UTSW	10	107719883	start gained	probably benign
R5862:Ptprq	UTSW	10	107565878	missense	probably benign	0.02
R5891:Ptprq	UTSW	10	107576895	missense	possibly damaging	0.94
R5916:Ptprq	UTSW	10	107523513	missense	probably damaging	1.00
R6054:Ptprq	UTSW	10	107582358	missense	probably damaging	1.00
R6058:Ptprq	UTSW	10	107635274	missense	probably benign	0.00
R6075:Ptprq	UTSW	10	107525760	missense	probably damaging	1.00
R6101:Ptprq	UTSW	10	107580266	missense	possibly damaging	0.93
R6189:Ptprq	UTSW	10	107517887	missense	probably damaging	1.00
R6235:Ptprq	UTSW	10	107635338	missense	possibly damaging	0.61
R6351:Ptprq	UTSW	10	107708668	missense	probably damaging	0.99
R6394:Ptprq	UTSW	10	107642943	nonsense	probably null
R6449:Ptprq	UTSW	10	107705583	missense	probably benign	0.00
R6526:Ptprq	UTSW	10	107542653	nonsense	probably null
R6544:Ptprq	UTSW	10	107608241	missense	probably damaging	1.00
R6609:Ptprq	UTSW	10	107572968	missense	probably damaging	0.99
R6862:Ptprq	UTSW	10	107686225	missense	probably damaging	0.96
R6874:Ptprq	UTSW	10	107718599	missense	possibly damaging	0.80
R6892:Ptprq	UTSW	10	107576004	missense	probably benign	0.00
R7082:Ptprq	UTSW	10	107708730	missense	probably benign	0.10
R7210:Ptprq	UTSW	10	107685171	missense	probably damaging	1.00
R7253:Ptprq	UTSW	10	107608273	missense	probably benign	0.30
R7293:Ptprq	UTSW	10	107635506	nonsense	probably null
R7445:Ptprq	UTSW	10	107590959	missense	probably damaging	1.00
R7632:Ptprq	UTSW	10	107711922	missense	probably benign	0.32
R7685:Ptprq	UTSW	10	107643978	missense	probably damaging	1.00
R7703:Ptprq	UTSW	10	107644146	missense	probably benign	0.01
R7774:Ptprq	UTSW	10	107643669	missense	probably damaging	0.96
R7897:Ptprq	UTSW	10	107710623	missense	probably benign	0.21
R7936:Ptprq	UTSW	10	107652711	missense	probably damaging	1.00
R7983:Ptprq	UTSW	10	107608411	nonsense	probably null
R8023:Ptprq	UTSW	10	107652616	nonsense	probably null
R8071:Ptprq	UTSW	10	107644035	missense	possibly damaging	0.62
R8084:Ptprq	UTSW	10	107608433	missense	probably benign
R8086:Ptprq	UTSW	10	107646639	nonsense	probably null
R8169:Ptprq	UTSW	10	107582490	missense	probably damaging	1.00
R8223:Ptprq	UTSW	10	107699638	missense	probably benign	0.00
R8235:Ptprq	UTSW	10	107582541	missense	probably damaging	1.00
R8235:Ptprq	UTSW	10	107705490	missense	probably benign	0.32
R8278:Ptprq	UTSW	10	107686378	missense	possibly damaging	0.87
R8710:Ptprq	UTSW	10	107576058	missense	possibly damaging	0.67
R8828:Ptprq	UTSW	10	107646652	missense	probably benign
R8830:Ptprq	UTSW	10	107586695	missense	possibly damaging	0.62
R8869:Ptprq	UTSW	10	107699608	missense	probably damaging	1.00
R9012:Ptprq	UTSW	10	107653550	missense	probably benign	0.09
R9072:Ptprq	UTSW	10	107565875	missense
R9153:Ptprq	UTSW	10	107580265	missense	probably damaging	0.98
R9202:Ptprq	UTSW	10	107686555	missense	probably damaging	1.00
R9252:Ptprq	UTSW	10	107686386	missense	probably benign	0.12
R9306:Ptprq	UTSW	10	107586738	missense	probably benign	0.00
R9492:Ptprq	UTSW	10	107642952	missense	probably damaging	1.00
R9519:Ptprq	UTSW	10	107685100	missense	probably damaging	1.00
R9581:Ptprq	UTSW	10	107711910	missense	possibly damaging	0.53
R9593:Ptprq	UTSW	10	107688393	missense	possibly damaging	0.92
R9621:Ptprq	UTSW	10	107542662	missense	probably damaging	1.00
R9732:Ptprq	UTSW	10	107576906	missense	probably damaging	1.00
R9743:Ptprq	UTSW	10	107685121	missense	probably damaging	1.00
R9771:Ptprq	UTSW	10	107685224	missense	probably damaging	0.99
R9788:Ptprq	UTSW	10	107565890	missense	probably benign	0.24
Z1088:Ptprq	UTSW	10	107699672	missense	possibly damaging	0.56
Z1176:Ptprq	UTSW	10	107526070	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCTGACCAACTGCATAATATG -3'
(R):5'- TATGGAGAGAAGTGCTGAACATGATTC -3'

Sequencing Primer
(F):5'- GACCAACTGCATAATATGATGAAAAC -3'
(R):5'- GTGCTGAACATGATTCATTTAACAC -3'

Posted On

2016-07-22