Incidental Mutation 'R5222:Dgke'
List |< first << previous [record 11 of 51] next >> last >|
ID402377
Institutional Source Beutler Lab
Gene Symbol Dgke
Ensembl Gene ENSMUSG00000000276
Gene Namediacylglycerol kinase, epsilon
SynonymsDAGK6
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location89035179-89066850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89050394 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 321 (T321K)
Ref Sequence ENSEMBL: ENSMUSP00000116277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000285] [ENSMUST00000107894] [ENSMUST00000152772]
Predicted Effect probably benign
Transcript: ENSMUST00000000285
AA Change: T321K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000285
Gene: ENSMUSG00000000276
AA Change: T321K

DomainStartEndE-ValueType
transmembrane domain 20 40 N/A INTRINSIC
C1 56 106 1.82e-4 SMART
C1 122 174 1.78e-7 SMART
DAGKc 216 347 3.69e-55 SMART
DAGKa 366 521 4.8e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107894
AA Change: T321K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103526
Gene: ENSMUSG00000000276
AA Change: T321K

DomainStartEndE-ValueType
transmembrane domain 20 40 N/A INTRINSIC
C1 56 106 1.82e-4 SMART
C1 122 174 1.78e-7 SMART
DAGKc 216 347 3.69e-55 SMART
DAGKa 366 521 4.8e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152772
AA Change: T321K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116277
Gene: ENSMUSG00000000276
AA Change: T321K

DomainStartEndE-ValueType
transmembrane domain 20 40 N/A INTRINSIC
C1 56 106 1.82e-4 SMART
C1 122 174 1.78e-7 SMART
DAGKc 216 347 3.69e-55 SMART
Pfam:DAGK_acc 366 406 9.7e-15 PFAM
Meta Mutation Damage Score 0.0815 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Diacylglycerol kinases are thought to be involved mainly in the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. When expressed in mammalian cells, DGK-epsilon shows specificity for arachidonyl-containing diacylglycerol. DGK-epsilon is expressed predominantly in testis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit reductions in susceptibility to electroconvulsive shock and arachidonoyldiacylglycerol accumulation in cerebral cortex, and attenuated long-term potentiation in dentate granular cell synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Dgke
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Dgke APN 11 89041501 missense probably benign 0.02
IGL00548:Dgke APN 11 89055371 missense probably benign
IGL01366:Dgke APN 11 89055386 missense probably benign 0.25
IGL01682:Dgke APN 11 89052441 missense probably damaging 1.00
IGL02942:Dgke APN 11 89055369 missense probably benign
R0479:Dgke UTSW 11 89052470 missense probably benign 0.01
R0653:Dgke UTSW 11 89060169 missense probably benign 0.01
R0735:Dgke UTSW 11 89060075 missense probably benign 0.18
R1471:Dgke UTSW 11 89055494 missense possibly damaging 0.76
R2267:Dgke UTSW 11 89052469 missense probably benign 0.00
R4297:Dgke UTSW 11 89050730 missense probably damaging 1.00
R4963:Dgke UTSW 11 89050802 missense possibly damaging 0.78
R5240:Dgke UTSW 11 89050685 missense probably damaging 1.00
R5864:Dgke UTSW 11 89050462 nonsense probably null
R6267:Dgke UTSW 11 89040749 missense probably benign
R6296:Dgke UTSW 11 89040749 missense probably benign
R6851:Dgke UTSW 11 89052483 missense probably benign 0.15
R7204:Dgke UTSW 11 89041480 missense probably damaging 1.00
R7216:Dgke UTSW 11 89050337 missense probably benign 0.01
R7895:Dgke UTSW 11 89040856 missense probably damaging 1.00
R8203:Dgke UTSW 11 89050367 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAAGTGCACAAATTTTGGC -3'
(R):5'- TGACGCTGATTAAGTAGTTAGCAC -3'

Sequencing Primer
(F):5'- TCAATGTCCCAAGTGCTGG -3'
(R):5'- GCACACTTACAGTTGTATTTGTGTC -3'
Posted On2016-07-22