Incidental Mutation 'R5222:Enpp7'
List |< first << previous [record 13 of 51] next >> last >|
ID402378
Institutional Source Beutler Lab
Gene Symbol Enpp7
Ensembl Gene ENSMUSG00000046697
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 7
SynonymsLOC238011, Alk-SMase
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118988188-118992841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118990962 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 311 (D311G)
Ref Sequence ENSEMBL: ENSMUSP00000090027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092373] [ENSMUST00000106273]
Predicted Effect probably benign
Transcript: ENSMUST00000092373
AA Change: D311G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000090027
Gene: ENSMUSG00000046697
AA Change: D311G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Phosphodiest 30 353 2.5e-76 PFAM
Pfam:Metalloenzyme 43 272 8.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106273
AA Change: D311G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101880
Gene: ENSMUSG00000046697
AA Change: D311G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Phosphodiest 30 353 3e-77 PFAM
Pfam:Metalloenzyme 41 257 5.2e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intestinal alkaline sphingomyelin phosphodiesterase that converts sphingomyelin to ceramide and phosphocholine. The encoded protein is anchored in the cell membrane, and it may function to protect the intestinal mucosa from inflammation and tumorigenesis. This protein is glycosylated and also exhibits lysophosphatidylcholine hydrolase activity. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit intestinal epithelium hypertrophy, decreased crypt and villi width, and impaired sphingomyelin digestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Enpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Enpp7 APN 11 118990545 missense probably damaging 1.00
IGL02488:Enpp7 APN 11 118988814 missense probably damaging 1.00
IGL02672:Enpp7 APN 11 118992340 critical splice donor site probably null
R0465:Enpp7 UTSW 11 118988781 missense probably damaging 1.00
R1718:Enpp7 UTSW 11 118990983 missense probably damaging 1.00
R2208:Enpp7 UTSW 11 118988762 splice site probably benign
R2970:Enpp7 UTSW 11 118990646 missense probably damaging 1.00
R3713:Enpp7 UTSW 11 118990518 missense probably damaging 1.00
R3967:Enpp7 UTSW 11 118991001 missense probably damaging 0.99
R5454:Enpp7 UTSW 11 118988808 missense probably benign 0.03
R5577:Enpp7 UTSW 11 118992127 missense probably benign 0.01
R7361:Enpp7 UTSW 11 118992159 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGATTATCACATCGGACCACGG -3'
(R):5'- GTACAGTGCTGAGTGTGTCC -3'

Sequencing Primer
(F):5'- TTATCACATCGGACCACGGTATGAC -3'
(R):5'- CCCTTGGTGGCTGATGTATCAC -3'
Posted On2016-07-22