Incidental Mutation 'R5222:Ubr7'
List |< first << previous [record 47 of 51] next >> last >|
ID402379
Institutional Source Beutler Lab
Gene Symbol Ubr7
Ensembl Gene ENSMUSG00000041712
Gene Nameubiquitin protein ligase E3 component n-recognin 7 (putative)
Synonyms
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102757967-102777707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102775705 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 399 (R399S)
Ref Sequence ENSEMBL: ENSMUSP00000041247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046404]
Predicted Effect probably benign
Transcript: ENSMUST00000046404
AA Change: R399S

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041247
Gene: ENSMUSG00000041712
AA Change: R399S

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:zf-UBR 45 113 2.4e-15 PFAM
PHD 134 186 1.78e-1 SMART
low complexity region 261 267 N/A INTRINSIC
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a UBR box-containing protein that belongs to the E3 ubiquitin ligase family. The protein also contains a plant homeodomain (PHD) in the C-terminus. In mammals, the encoded protein recognizes N-degrons, the destabilizing N-terminal residues of short-lived proteins, which results in ubiquitinylation, and proteolysis via the proteasome. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Ubr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Ubr7 APN 12 102768276 nonsense probably null
IGL02493:Ubr7 APN 12 102768220 missense probably benign 0.00
IGL02750:Ubr7 APN 12 102771278 missense possibly damaging 0.68
IGL03229:Ubr7 APN 12 102769155 missense probably damaging 1.00
dwindled UTSW 12 102761464 missense probably damaging 1.00
R0519:Ubr7 UTSW 12 102768206 missense probably benign 0.00
R0894:Ubr7 UTSW 12 102769191 missense probably damaging 1.00
R1453:Ubr7 UTSW 12 102769178 missense probably benign 0.00
R1598:Ubr7 UTSW 12 102769894 missense probably damaging 1.00
R2201:Ubr7 UTSW 12 102761505 critical splice donor site probably null
R4731:Ubr7 UTSW 12 102769226 missense probably benign 0.03
R4834:Ubr7 UTSW 12 102761502 missense probably damaging 1.00
R5662:Ubr7 UTSW 12 102768267 missense probably benign 0.00
R5845:Ubr7 UTSW 12 102766312 missense probably damaging 0.99
R5867:Ubr7 UTSW 12 102761494 missense probably damaging 1.00
R6257:Ubr7 UTSW 12 102765840 nonsense probably null
R6543:Ubr7 UTSW 12 102768235 missense probably benign 0.01
R6601:Ubr7 UTSW 12 102761464 missense probably damaging 1.00
R6849:Ubr7 UTSW 12 102758083 missense probably damaging 0.98
R7330:Ubr7 UTSW 12 102775712 missense probably damaging 0.99
R7576:Ubr7 UTSW 12 102769139 missense probably damaging 1.00
R8256:Ubr7 UTSW 12 102769911 missense probably damaging 1.00
R8334:Ubr7 UTSW 12 102758138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTAATCCTGTGGTGAGTGGAG -3'
(R):5'- ACCCTGCAGCTACTTAAGGAG -3'

Sequencing Primer
(F):5'- ACTGGGACACATTAGGTAGCCC -3'
(R):5'- CAGCTACTTAAGGAGAAGGCCTG -3'
Posted On2016-07-22