Incidental Mutation 'R0415:Sult2b1'
ID 40238
Institutional Source Beutler Lab
Gene Symbol Sult2b1
Ensembl Gene ENSMUSG00000003271
Gene Name sulfotransferase family, cytosolic, 2B, member 1
Synonyms SULT2B, Gm5897
MMRRC Submission 038617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R0415 (G1)
Quality Score 177
Status Validated
Chromosome 7
Chromosomal Location 45379405-45409096 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 45379516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075571] [ENSMUST00000094424] [ENSMUST00000129507] [ENSMUST00000209739] [ENSMUST00000210754]
AlphaFold O35400
Predicted Effect unknown
Transcript: ENSMUST00000075571
AA Change: S309P
SMART Domains Protein: ENSMUSP00000075005
Gene: ENSMUSG00000003271
AA Change: S309P

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 57 302 7.8e-84 PFAM
low complexity region 309 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094424
SMART Domains Protein: ENSMUSP00000091991
Gene: ENSMUSG00000070563

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:UPAR_LY6 23 97 1.7e-7 PFAM
low complexity region 99 123 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107735
AA Change: S343P
SMART Domains Protein: ENSMUSP00000103363
Gene: ENSMUSG00000003271
AA Change: S343P

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 91 336 5.2e-84 PFAM
Pfam:Sulfotransfer_3 92 262 5.1e-11 PFAM
low complexity region 343 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129507
SMART Domains Protein: ENSMUSP00000114397
Gene: ENSMUSG00000054161

DomainStartEndE-ValueType
Pfam:DUF1669 18 293 4.8e-105 PFAM
low complexity region 371 385 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209739
AA Change: S341P
Predicted Effect unknown
Transcript: ENSMUST00000210754
AA Change: S343P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211124
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene sulfates dehydroepiandrosterone but not 4-nitrophenol, a typical substrate for the phenol and estrogen sulfotransferase subfamilies. Two alternatively spliced variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack cholesterol sulfate in the dermis but otherwise appear to have normal lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 24,036,048 (GRCm39) noncoding transcript Het
Acox2 A G 14: 8,243,835 (GRCm38) probably benign Het
Adgb T C 10: 10,306,811 (GRCm39) probably null Het
Adgra3 C A 5: 50,119,099 (GRCm39) probably benign Het
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ahnak A G 19: 8,990,235 (GRCm39) probably benign Het
Anapc2 A G 2: 25,168,337 (GRCm39) T159A probably damaging Het
Arfgef3 A G 10: 18,488,875 (GRCm39) probably benign Het
Atf7ip C T 6: 136,537,010 (GRCm39) S81L possibly damaging Het
Cacna1i A G 15: 80,253,031 (GRCm39) probably benign Het
Camk1 A T 6: 113,318,852 (GRCm39) Y20* probably null Het
Ccdc40 T C 11: 119,122,944 (GRCm39) Y249H possibly damaging Het
Cd109 T A 9: 78,619,897 (GRCm39) S1380T probably benign Het
Cfap57 A T 4: 118,426,628 (GRCm39) L1107Q possibly damaging Het
Col6a4 C T 9: 105,952,279 (GRCm39) V540I probably damaging Het
Cst9 T A 2: 148,680,362 (GRCm39) probably benign Het
Cul5 C T 9: 53,578,370 (GRCm39) V73I probably benign Het
Cxcl16 T A 11: 70,349,574 (GRCm39) K84* probably null Het
Cyp2c29 T C 19: 39,317,539 (GRCm39) probably benign Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dip2c C T 13: 9,618,325 (GRCm39) probably benign Het
Dis3 A T 14: 99,324,892 (GRCm39) I513N probably damaging Het
Dnajc16 A T 4: 141,516,359 (GRCm39) L3* probably null Het
Dop1a T A 9: 86,388,555 (GRCm39) L480M probably damaging Het
Eml6 A G 11: 29,699,392 (GRCm39) V1787A possibly damaging Het
Etnk1 A G 6: 143,126,500 (GRCm39) N115S probably damaging Het
Fryl T C 5: 73,255,757 (GRCm39) Y758C probably damaging Het
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Ggnbp2 A C 11: 84,724,051 (GRCm39) probably benign Het
Gm7137 A G 10: 77,624,007 (GRCm39) probably benign Het
Gstm2 T A 3: 107,891,322 (GRCm39) Q132L probably benign Het
Habp2 T C 19: 56,306,149 (GRCm39) probably benign Het
Hectd2 T C 19: 36,562,284 (GRCm39) probably benign Het
Htr6 A G 4: 138,789,392 (GRCm39) I291T possibly damaging Het
Ighg2c T C 12: 113,251,530 (GRCm39) D199G unknown Het
Itih2 A G 2: 10,110,426 (GRCm39) probably benign Het
Kcnab2 A G 4: 152,479,593 (GRCm39) F248S probably benign Het
Kcnc4 T C 3: 107,352,749 (GRCm39) K610E probably damaging Het
Kcnk16 T A 14: 20,313,043 (GRCm39) probably null Het
Kndc1 C T 7: 139,510,037 (GRCm39) T1293I probably damaging Het
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Lrrc8d T C 5: 105,959,731 (GRCm39) L47P probably damaging Het
Lyset T A 12: 102,711,135 (GRCm39) Y119* probably null Het
Lyst T C 13: 13,886,195 (GRCm39) probably benign Het
Macrod2 G A 2: 142,052,065 (GRCm39) probably null Het
Mical2 C T 7: 111,980,235 (GRCm39) R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,759,576 (GRCm39) probably benign Het
Msh3 A G 13: 92,483,294 (GRCm39) V283A possibly damaging Het
Nup205 T C 6: 35,191,569 (GRCm39) probably benign Het
Nxpe2 T C 9: 48,237,914 (GRCm39) T114A probably damaging Het
Or51e2 C T 7: 102,391,294 (GRCm39) M305I probably benign Het
Or5m10 A T 2: 85,717,782 (GRCm39) I213F possibly damaging Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Or8c15 A T 9: 38,121,269 (GRCm39) M305L probably benign Het
Or8g2 A G 9: 39,821,279 (GRCm39) Y60C probably damaging Het
Pard3 G A 8: 128,337,047 (GRCm39) G1221D probably damaging Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Pcsk6 C T 7: 65,683,622 (GRCm39) R746C probably damaging Het
Pif1 G A 9: 65,495,333 (GRCm39) C81Y probably benign Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Plcd4 C A 1: 74,591,256 (GRCm39) S217Y probably damaging Het
Plxna1 G A 6: 89,334,318 (GRCm39) H104Y probably benign Het
Polr2k A G 15: 36,175,602 (GRCm39) Y45C probably damaging Het
Prex1 A G 2: 166,428,619 (GRCm39) probably benign Het
Pth2r A G 1: 65,427,598 (GRCm39) M424V probably benign Het
Pygm A G 19: 6,441,396 (GRCm39) R464G probably benign Het
Rad51c A G 11: 87,288,481 (GRCm39) L234P probably damaging Het
Rnf145 A G 11: 44,415,965 (GRCm39) Y60C probably damaging Het
Rnf167 T C 11: 70,540,525 (GRCm39) I135T probably damaging Het
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ro60 G T 1: 143,635,813 (GRCm39) N444K probably benign Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Het
Selenbp1 T C 3: 94,844,224 (GRCm39) V27A possibly damaging Het
Selenof T G 3: 144,283,453 (GRCm39) L14R probably damaging Het
Sfswap A T 5: 129,581,190 (GRCm39) D121V probably damaging Het
Slc25a34 C A 4: 141,347,780 (GRCm39) M300I possibly damaging Het
Slc34a3 T G 2: 25,119,122 (GRCm39) T583P probably benign Het
Slc66a3 C A 12: 17,047,711 (GRCm39) probably benign Het
Smg1 C A 7: 117,781,691 (GRCm39) A1199S probably benign Het
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Sptbn1 A C 11: 30,099,576 (GRCm39) N229K probably damaging Het
Tas2r123 A T 6: 132,824,801 (GRCm39) M233L probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem132c A G 5: 127,640,769 (GRCm39) E980G probably damaging Het
Tmem247 G T 17: 87,229,750 (GRCm39) C197F probably damaging Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Het
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Ubr5 T C 15: 37,973,224 (GRCm39) T2626A probably damaging Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Het
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Het
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Vmn2r74 A C 7: 85,610,618 (GRCm39) C25G probably damaging Het
Xndc1 T C 7: 101,729,823 (GRCm39) probably benign Het
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Het
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Het
Zfp316 T A 5: 143,250,246 (GRCm39) T56S unknown Het
Zfp345 A G 2: 150,316,479 (GRCm39) probably benign Het
Other mutations in Sult2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02415:Sult2b1 APN 7 45,391,509 (GRCm39) missense possibly damaging 0.86
IGL02964:Sult2b1 APN 7 45,384,698 (GRCm39) missense probably benign 0.01
IGL03208:Sult2b1 APN 7 45,383,053 (GRCm39) missense probably damaging 1.00
R0392:Sult2b1 UTSW 7 45,383,062 (GRCm39) missense probably damaging 1.00
R2247:Sult2b1 UTSW 7 45,384,734 (GRCm39) missense probably damaging 1.00
R3851:Sult2b1 UTSW 7 45,379,461 (GRCm39) unclassified probably benign
R3935:Sult2b1 UTSW 7 45,391,640 (GRCm39) missense probably benign 0.09
R3936:Sult2b1 UTSW 7 45,391,640 (GRCm39) missense probably benign 0.09
R4179:Sult2b1 UTSW 7 45,384,735 (GRCm39) missense probably damaging 1.00
R4723:Sult2b1 UTSW 7 45,391,489 (GRCm39) missense probably damaging 1.00
R5634:Sult2b1 UTSW 7 45,383,506 (GRCm39) missense probably damaging 0.99
R5782:Sult2b1 UTSW 7 45,380,770 (GRCm39) missense probably damaging 1.00
R6562:Sult2b1 UTSW 7 45,391,670 (GRCm39) missense probably benign 0.00
R6816:Sult2b1 UTSW 7 45,383,102 (GRCm39) missense probably damaging 1.00
R6921:Sult2b1 UTSW 7 45,384,612 (GRCm39) missense probably damaging 1.00
R7145:Sult2b1 UTSW 7 45,383,056 (GRCm39) missense probably damaging 1.00
R7250:Sult2b1 UTSW 7 45,433,361 (GRCm39) missense unknown
R7392:Sult2b1 UTSW 7 45,391,862 (GRCm39) start gained probably benign
R7398:Sult2b1 UTSW 7 45,380,718 (GRCm39) missense probably damaging 1.00
R7691:Sult2b1 UTSW 7 45,384,708 (GRCm39) missense probably benign 0.01
R7712:Sult2b1 UTSW 7 45,379,620 (GRCm39) missense probably benign 0.15
R8239:Sult2b1 UTSW 7 45,433,361 (GRCm39) missense unknown
R9159:Sult2b1 UTSW 7 45,391,534 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATCCTGACTTCAAGCTCAGTG -3'
(R):5'- CTGAGGGGACATCCAACAAGGC -3'

Sequencing Primer
(F):5'- caatcccactgcctccac -3'
(R):5'- TCCAACAAGGCTGAGACG -3'
Posted On 2013-05-23