Incidental Mutation 'R5222:Esyt2'
List |< first << previous [record 16 of 51] next >> last >|
ID402380
Institutional Source Beutler Lab
Gene Symbol Esyt2
Ensembl Gene ENSMUSG00000021171
Gene Nameextended synaptotagmin-like protein 2
Synonyms4921504I16Rik, D12Ertd551e, 2410017M09Rik, Fam62b
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location116281196-116391050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116318826 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 132 (F132S)
Ref Sequence ENSEMBL: ENSMUSP00000152444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100986] [ENSMUST00000220720] [ENSMUST00000220816]
Predicted Effect probably damaging
Transcript: ENSMUST00000100986
AA Change: F132S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098548
Gene: ENSMUSG00000021171
AA Change: F132S

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:SMP_LBD 115 294 3e-125 PFAM
C2 310 412 1.39e-14 SMART
C2 461 556 2.59e-14 SMART
low complexity region 660 669 N/A INTRINSIC
C2 726 831 5.51e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220720
AA Change: F132S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220754
Predicted Effect probably damaging
Transcript: ENSMUST00000220816
AA Change: F132S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221584
Meta Mutation Damage Score 0.2444 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects except reduced FGF-stimulated mouse embryonic fibroblast migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Esyt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Esyt2 APN 12 116363444 missense probably damaging 1.00
IGL01636:Esyt2 APN 12 116365930 critical splice donor site probably null
IGL01912:Esyt2 APN 12 116339609 missense probably damaging 1.00
IGL02310:Esyt2 APN 12 116365921 missense probably benign 0.06
PIT4802001:Esyt2 UTSW 12 116365837 missense probably benign 0.00
R0134:Esyt2 UTSW 12 116367710 missense probably damaging 0.98
R0225:Esyt2 UTSW 12 116367710 missense probably damaging 0.98
R0313:Esyt2 UTSW 12 116347808 missense probably damaging 1.00
R0532:Esyt2 UTSW 12 116357198 splice site probably benign
R2324:Esyt2 UTSW 12 116367821 missense possibly damaging 0.50
R4610:Esyt2 UTSW 12 116318890 missense probably damaging 0.99
R4898:Esyt2 UTSW 12 116342088 missense probably benign 0.06
R4918:Esyt2 UTSW 12 116324140 missense probably benign 0.30
R5052:Esyt2 UTSW 12 116367796 missense probably damaging 1.00
R5800:Esyt2 UTSW 12 116370188 missense possibly damaging 0.94
R6499:Esyt2 UTSW 12 116321170 missense probably damaging 0.98
R6607:Esyt2 UTSW 12 116368740 missense probably benign 0.18
R6951:Esyt2 UTSW 12 116324130 missense probably benign 0.21
R7153:Esyt2 UTSW 12 116346508 missense probably benign 0.00
R7173:Esyt2 UTSW 12 116363534 missense probably benign 0.05
R7227:Esyt2 UTSW 12 116342125 missense probably damaging 1.00
R7248:Esyt2 UTSW 12 116342238 missense probably damaging 1.00
R7509:Esyt2 UTSW 12 116365876 missense probably damaging 1.00
R7780:Esyt2 UTSW 12 116342098 missense probably benign 0.15
R8077:Esyt2 UTSW 12 116342228 missense possibly damaging 0.54
R8136:Esyt2 UTSW 12 116363459 missense probably benign
R8264:Esyt2 UTSW 12 116365920 missense probably benign 0.00
R8350:Esyt2 UTSW 12 116363482 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGCATATTGGCTAATCAGTAG -3'
(R):5'- CTACTGTGTGCATGAGGAAGG -3'

Sequencing Primer
(F):5'- CACATTTTGCAGGACTGATTTTG -3'
(R):5'- TGCATGAGGAAGGGCAGAACTG -3'
Posted On2016-07-22