Incidental Mutation 'R5222:Rad17'
ID402382
Institutional Source Beutler Lab
Gene Symbol Rad17
Ensembl Gene ENSMUSG00000021635
Gene NameRAD17 checkpoint clamp loader component
SynonymsMmRad24, 9430035O09Rik
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100617164-100651051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100633891 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 216 (T216I)
Ref Sequence ENSEMBL: ENSMUSP00000136292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022136] [ENSMUST00000177848] [ENSMUST00000226050]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022136
AA Change: T216I

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635
AA Change: T216I

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177848
AA Change: T216I

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136292
Gene: ENSMUSG00000021635
AA Change: T216I

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225155
Predicted Effect probably benign
Transcript: ENSMUST00000226050
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with incomplete somite formation, abnormal bracnchial arch, liver, and heart morphology, abnormal neural tube development, and multiple hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Rad17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Rad17 APN 13 100629525 missense probably benign 0.03
IGL00422:Rad17 APN 13 100629523 missense probably damaging 0.98
IGL00478:Rad17 APN 13 100633274 missense probably damaging 1.00
IGL01328:Rad17 APN 13 100617803 missense probably benign
IGL01720:Rad17 APN 13 100622858 missense possibly damaging 0.51
IGL01874:Rad17 APN 13 100617684 utr 3 prime probably benign
IGL02305:Rad17 APN 13 100633862 critical splice donor site probably null
IGL02541:Rad17 APN 13 100633443 splice site probably benign
R0678:Rad17 UTSW 13 100645184 missense possibly damaging 0.73
R1079:Rad17 UTSW 13 100633899 missense probably benign 0.01
R1422:Rad17 UTSW 13 100645082 missense probably benign 0.18
R1730:Rad17 UTSW 13 100622806 missense probably damaging 0.97
R3946:Rad17 UTSW 13 100622863 missense possibly damaging 0.70
R4577:Rad17 UTSW 13 100633278 missense probably damaging 1.00
R4735:Rad17 UTSW 13 100619129 missense probably damaging 0.98
R5023:Rad17 UTSW 13 100645063 missense possibly damaging 0.88
R5098:Rad17 UTSW 13 100617646 makesense probably null
R5511:Rad17 UTSW 13 100627649 missense possibly damaging 0.82
R5536:Rad17 UTSW 13 100631104 missense probably damaging 1.00
R5887:Rad17 UTSW 13 100633861 critical splice donor site probably null
R6041:Rad17 UTSW 13 100617766 missense probably benign 0.01
R6173:Rad17 UTSW 13 100622881 missense probably benign
R6342:Rad17 UTSW 13 100619136 missense probably damaging 1.00
R6465:Rad17 UTSW 13 100637080 missense probably benign 0.34
R6730:Rad17 UTSW 13 100649745 start gained probably benign
R6890:Rad17 UTSW 13 100637084 missense probably benign 0.34
R6947:Rad17 UTSW 13 100622875 missense probably damaging 1.00
R7035:Rad17 UTSW 13 100627625 missense possibly damaging 0.78
R7113:Rad17 UTSW 13 100629517 missense probably benign 0.03
R7408:Rad17 UTSW 13 100629511 nonsense probably null
R7553:Rad17 UTSW 13 100633286 missense probably damaging 1.00
R7573:Rad17 UTSW 13 100629466 missense probably damaging 0.99
R8313:Rad17 UTSW 13 100624566 missense probably benign 0.02
RF022:Rad17 UTSW 13 100637085 missense probably damaging 1.00
Z1176:Rad17 UTSW 13 100627632 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGCTGAGAATTATGCTAGCATACAG -3'
(R):5'- TGGTGTAGAAGAAAATTACTATTGTCC -3'

Sequencing Primer
(F):5'- TCCTGCATCTCACAGTTG -3'
(R):5'- AACTTCTCTGTAGTTCCATACC -3'
Posted On2016-07-22