Incidental Mutation 'R5222:Rpp14'
ID 402384
Institutional Source Beutler Lab
Gene Symbol Rpp14
Ensembl Gene ENSMUSG00000023156
Gene Name ribonuclease P 14 subunit
Synonyms 2610511E03Rik
MMRRC Submission 042795-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R5222 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 14377939-14389406 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8087513 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 69 (L69P)
Ref Sequence ENSEMBL: ENSMUSP00000023924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023924] [ENSMUST00000180369]
AlphaFold Q9CQH8
Predicted Effect probably damaging
Transcript: ENSMUST00000023924
AA Change: L69P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023924
Gene: ENSMUSG00000023156
AA Change: L69P

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 8 109 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180369
SMART Domains Protein: ENSMUSP00000136494
Gene: ENSMUSG00000023156

DomainStartEndE-ValueType
Pfam:MaoC_dehydratas 22 142 2e-21 PFAM
Pfam:MaoC_dehydrat_N 26 148 6.4e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 159,872,178 (GRCm39) noncoding transcript Het
Acad11 G A 9: 103,974,576 (GRCm39) A515T probably damaging Het
Angpt1 T C 15: 42,539,730 (GRCm39) Y43C probably damaging Het
Arhgef33 A G 17: 80,644,743 (GRCm39) Y24C probably damaging Het
Cd40 G C 2: 164,908,464 (GRCm39) S180T probably benign Het
Cenpc1 A T 5: 86,185,606 (GRCm39) S302T possibly damaging Het
Cit C A 5: 116,090,602 (GRCm39) T932K probably benign Het
Col19a1 A C 1: 24,598,721 (GRCm39) probably null Het
Dapk3 A G 10: 81,028,294 (GRCm39) E288G probably damaging Het
Ddx60 T C 8: 62,437,192 (GRCm39) F1002S probably damaging Het
Dgke G T 11: 88,941,220 (GRCm39) T321K probably benign Het
Ebf2 T G 14: 67,551,043 (GRCm39) probably benign Het
Enpp7 A G 11: 118,881,788 (GRCm39) D311G probably benign Het
Epm2a A G 10: 11,324,493 (GRCm39) E194G probably damaging Het
Esf1 A G 2: 140,000,503 (GRCm39) Y428H possibly damaging Het
Esyt2 T C 12: 116,282,446 (GRCm39) F132S probably damaging Het
Gm5455 T C 13: 110,441,494 (GRCm39) noncoding transcript Het
Gria1 T A 11: 57,080,623 (GRCm39) V202E probably benign Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Mark1 A T 1: 184,660,288 (GRCm39) F123I probably damaging Het
Nectin4 T A 1: 171,212,825 (GRCm39) probably null Het
Obscn T A 11: 58,934,971 (GRCm39) T5220S possibly damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2l13 A C 16: 19,305,680 (GRCm39) I31L probably benign Het
Or2p2 T A 13: 21,256,739 (GRCm39) H244L probably damaging Het
Pdcd1 A T 1: 93,980,175 (GRCm39) V14E probably damaging Het
Pmel A G 10: 128,554,853 (GRCm39) probably null Het
Pramel28 T A 4: 143,691,362 (GRCm39) I454F possibly damaging Het
Prrx1 C T 1: 163,089,542 (GRCm39) R95Q probably damaging Het
Pstpip2 T A 18: 77,962,032 (GRCm39) Y267* probably null Het
Ptprq A G 10: 107,498,425 (GRCm39) I884T probably damaging Het
Rad17 G A 13: 100,770,399 (GRCm39) T216I possibly damaging Het
Rif1 T C 2: 51,967,032 (GRCm39) I107T probably benign Het
Rtel1 G T 2: 180,988,776 (GRCm39) probably benign Het
Sap130 C T 18: 31,799,756 (GRCm39) T362M probably damaging Het
Scn11a A G 9: 119,644,268 (GRCm39) probably null Het
Sec31a G T 5: 100,530,754 (GRCm39) T243N probably benign Het
Slc5a9 T A 4: 111,755,808 (GRCm39) H30L possibly damaging Het
Slco6b1 T A 1: 96,925,216 (GRCm39) noncoding transcript Het
Smarca4 A G 9: 21,567,002 (GRCm39) D694G probably benign Het
Spaca6 A G 17: 18,058,367 (GRCm39) T213A probably benign Het
Tagap C A 17: 8,152,473 (GRCm39) Q553K possibly damaging Het
Tagap A T 17: 8,152,474 (GRCm39) Q553L possibly damaging Het
Tcf7l2 A G 19: 55,887,044 (GRCm39) Q19R probably benign Het
Ttn A G 2: 76,709,197 (GRCm39) probably benign Het
Ubr7 A T 12: 102,741,964 (GRCm39) R399S probably benign Het
Uspl1 C A 5: 149,150,911 (GRCm39) Q690K possibly damaging Het
Vps8 T A 16: 21,400,298 (GRCm39) Y853* probably null Het
Vrk3 A T 7: 44,409,220 (GRCm39) Q129L possibly damaging Het
Wapl T A 14: 34,458,642 (GRCm39) C901* probably null Het
Other mutations in Rpp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Rpp14 APN 14 8,083,934 (GRCm38) missense possibly damaging 0.78
IGL00424:Rpp14 APN 14 8,083,934 (GRCm38) missense possibly damaging 0.78
IGL00478:Rpp14 APN 14 8,083,934 (GRCm38) missense possibly damaging 0.78
IGL00538:Rpp14 APN 14 8,083,934 (GRCm38) missense possibly damaging 0.78
R1167:Rpp14 UTSW 14 8,083,705 (GRCm38) splice site probably null
R1499:Rpp14 UTSW 14 8,090,528 (GRCm38) missense probably benign 0.18
R1874:Rpp14 UTSW 14 8,090,145 (GRCm38) missense probably benign
R4778:Rpp14 UTSW 14 8,090,203 (GRCm38) missense probably benign 0.08
R5561:Rpp14 UTSW 14 8,090,558 (GRCm38) splice site probably null
R6015:Rpp14 UTSW 14 8,090,462 (GRCm38) missense probably benign 0.00
R6801:Rpp14 UTSW 14 8,083,717 (GRCm38) start gained probably benign
R7643:Rpp14 UTSW 14 8,090,325 (GRCm38) nonsense probably null
R7685:Rpp14 UTSW 14 8,090,453 (GRCm38) missense probably damaging 0.98
R7872:Rpp14 UTSW 14 8,083,724 (GRCm38) start codon destroyed probably null 0.00
R8259:Rpp14 UTSW 14 8,090,526 (GRCm38) missense probably null 0.94
R8491:Rpp14 UTSW 14 8,083,925 (GRCm38) missense possibly damaging 0.70
R8973:Rpp14 UTSW 14 8,088,768 (GRCm38) missense probably benign
R9035:Rpp14 UTSW 14 8,083,772 (GRCm38) missense possibly damaging 0.92
Z1088:Rpp14 UTSW 14 8,090,539 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTAGGAATATCCCAGACAATG -3'
(R):5'- TCTCTAACTAGCATAACTCCAGTGGA -3'

Sequencing Primer
(F):5'- CCAGACAATGGGAGCTCTAAGC -3'
(R):5'- GATCTCTAAGATGGAGTCTGAACCC -3'
Posted On 2016-07-22