Incidental Mutation 'R5222:Rpp14'
List |< first << previous [record 34 of 51] next >> last >|
ID402384
Institutional Source Beutler Lab
Gene Symbol Rpp14
Ensembl Gene ENSMUSG00000023156
Gene Nameribonuclease P 14 subunit
Synonyms2610511E03Rik
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location8080367-8091834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8087513 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 69 (L69P)
Ref Sequence ENSEMBL: ENSMUSP00000023924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023924] [ENSMUST00000180369]
Predicted Effect probably damaging
Transcript: ENSMUST00000023924
AA Change: L69P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023924
Gene: ENSMUSG00000023156
AA Change: L69P

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 8 109 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180369
SMART Domains Protein: ENSMUSP00000136494
Gene: ENSMUSG00000023156

DomainStartEndE-ValueType
Pfam:MaoC_dehydratas 22 142 2e-21 PFAM
Pfam:MaoC_dehydrat_N 26 148 6.4e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Rpp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Rpp14 APN 14 8083934 missense possibly damaging 0.78
IGL00424:Rpp14 APN 14 8083934 missense possibly damaging 0.78
IGL00478:Rpp14 APN 14 8083934 missense possibly damaging 0.78
IGL00538:Rpp14 APN 14 8083934 missense possibly damaging 0.78
R1167:Rpp14 UTSW 14 8083705 splice site probably null
R1499:Rpp14 UTSW 14 8090528 missense probably benign 0.18
R1874:Rpp14 UTSW 14 8090145 missense probably benign
R4778:Rpp14 UTSW 14 8090203 missense probably benign 0.08
R5561:Rpp14 UTSW 14 8090558 unclassified probably null
R6015:Rpp14 UTSW 14 8090462 missense probably benign 0.00
R6801:Rpp14 UTSW 14 8083717 start gained probably benign
R7643:Rpp14 UTSW 14 8090325 nonsense probably null
R7685:Rpp14 UTSW 14 8090453 missense probably damaging 0.98
R7872:Rpp14 UTSW 14 8083724 start codon destroyed probably null 0.00
R8259:Rpp14 UTSW 14 8090526 missense probably null 0.94
Z1088:Rpp14 UTSW 14 8090539 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTAGGAATATCCCAGACAATG -3'
(R):5'- TCTCTAACTAGCATAACTCCAGTGGA -3'

Sequencing Primer
(F):5'- CCAGACAATGGGAGCTCTAAGC -3'
(R):5'- GATCTCTAAGATGGAGTCTGAACCC -3'
Posted On2016-07-22