Mutagenetix > Incidental Mutation

Incidental Mutation 'R5222:Wapl'

402385

Institutional Source

Beutler Lab

Gene Symbol

Wapl

Ensembl Gene

ENSMUSG00000041408

Gene Name

WAPL cohesin release factor

Synonyms

A530089A20Rik, Wapal

MMRRC Submission

042795-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5222 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34673928-34747983 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 34736685 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 901 (C901*)

Ref Sequence

ENSEMBL: ENSMUSP00000130547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]

AlphaFold

Q65Z40

Predicted Effect

probably null
Transcript: ENSMUST00000048263
AA Change: C901*

SMART Domains

Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: C901*

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	645	1009	6.5e-153	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000090027
AA Change: C895*

SMART Domains

Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: C895*

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	639	1003	2.6e-153	PFAM
low complexity region	1012	1027	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111895

Predicted Effect

probably null
Transcript: ENSMUST00000151285
AA Change: C185*

SMART Domains

Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: C185*

Domain	Start	End	E-Value	Type
Pfam:WAPL	1	281	1.1e-78	PFAM
coiled coil region	329	351	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000169910
AA Change: C901*

SMART Domains

Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: C901*

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	647	1008	3.5e-120	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174559

SMART Domains

Protein: ENSMUSP00000133779
Gene: ENSMUSG00000041408

Domain	Start	End	E-Value	Type
Pfam:WAPL	1	55	8.6e-22	PFAM
low complexity region	64	79	N/A	INTRINSIC
coiled coil region	119	141	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	C	A	1: 160,044,608		noncoding transcript	Het
Acad11	G	A	9: 104,097,377	A515T	probably damaging	Het
Angpt1	T	C	15: 42,676,334	Y43C	probably damaging	Het
Arhgef33	A	G	17: 80,337,314	Y24C	probably damaging	Het
Cd40	G	C	2: 165,066,544	S180T	probably benign	Het
Cenpc1	A	T	5: 86,037,747	S302T	possibly damaging	Het
Cit	C	A	5: 115,952,543	T932K	probably benign	Het
Col19a1	A	C	1: 24,559,640		probably null	Het
Dapk3	A	G	10: 81,192,460	E288G	probably damaging	Het
Ddx60	T	C	8: 61,984,158	F1002S	probably damaging	Het
Dgke	G	T	11: 89,050,394	T321K	probably benign	Het
Ebf2	T	G	14: 67,313,594		probably benign	Het
Enpp7	A	G	11: 118,990,962	D311G	probably benign	Het
Epm2a	A	G	10: 11,448,749	E194G	probably damaging	Het
Esf1	A	G	2: 140,158,583	Y428H	possibly damaging	Het
Esyt2	T	C	12: 116,318,826	F132S	probably damaging	Het
Gm13101	T	A	4: 143,964,792	I454F	possibly damaging	Het
Gm5455	T	C	13: 110,304,960		noncoding transcript	Het
Gria1	T	A	11: 57,189,797	V202E	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Mark1	A	T	1: 184,928,091	F123I	probably damaging	Het
Nectin4	T	A	1: 171,385,257		probably null	Het
Obscn	T	A	11: 59,044,145	T5220S	possibly damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1370	T	A	13: 21,072,569	H244L	probably damaging	Het
Olfr166	A	C	16: 19,486,930	I31L	probably benign	Het
Pdcd1	A	T	1: 94,052,450	V14E	probably damaging	Het
Pmel	A	G	10: 128,718,984		probably null	Het
Prrx1	C	T	1: 163,261,973	R95Q	probably damaging	Het
Pstpip2	T	A	18: 77,874,332	Y267*	probably null	Het
Ptprq	A	G	10: 107,662,564	I884T	probably damaging	Het
Rad17	G	A	13: 100,633,891	T216I	possibly damaging	Het
Rif1	T	C	2: 52,077,020	I107T	probably benign	Het
Rpp14	T	C	14: 8,087,513	L69P	probably damaging	Het
Rtel1	G	T	2: 181,346,983		probably benign	Het
Sap130	C	T	18: 31,666,703	T362M	probably damaging	Het
Scn11a	A	G	9: 119,815,202		probably null	Het
Sec31a	G	T	5: 100,382,895	T243N	probably benign	Het
Slc5a9	T	A	4: 111,898,611	H30L	possibly damaging	Het
Slco6b1	T	A	1: 96,997,491		noncoding transcript	Het
Smarca4	A	G	9: 21,655,706	D694G	probably benign	Het
Spaca6	A	G	17: 17,838,105	T213A	probably benign	Het
Tagap	C	A	17: 7,933,641	Q553K	possibly damaging	Het
Tagap	A	T	17: 7,933,642	Q553L	possibly damaging	Het
Tcf7l2	A	G	19: 55,898,612	Q19R	probably benign	Het
Ttn	A	G	2: 76,878,853		probably benign	Het
Ubr7	A	T	12: 102,775,705	R399S	probably benign	Het
Uspl1	C	A	5: 149,214,101	Q690K	possibly damaging	Het
Vps8	T	A	16: 21,581,548	Y853*	probably null	Het
Vrk3	A	T	7: 44,759,796	Q129L	possibly damaging	Het

Other mutations in Wapl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Wapl	APN	14	34692636	missense	probably benign	0.00
IGL00539:Wapl	APN	14	34695008	missense	probably damaging	1.00
IGL00846:Wapl	APN	14	34692744	splice site	probably benign
IGL01070:Wapl	APN	14	34745622	unclassified	probably benign
IGL01516:Wapl	APN	14	34692081	missense	probably damaging	1.00
IGL02021:Wapl	APN	14	34722336	missense	probably benign
IGL02209:Wapl	APN	14	34677261	missense	possibly damaging	0.46
IGL02309:Wapl	APN	14	34744863	missense	probably damaging	0.98
IGL02471:Wapl	APN	14	34691920	missense	possibly damaging	0.68
IGL02965:Wapl	APN	14	34739224	intron	probably benign
IGL03076:Wapl	APN	14	34692089	missense	probably benign	0.26
IGL03197:Wapl	APN	14	34745631	missense	possibly damaging	0.77
Mcclintock	UTSW	14	34730662	critical splice donor site	probably null
Tatum	UTSW	14	34729195	missense	probably damaging	1.00
R0045:Wapl	UTSW	14	34733794	missense	probably benign	0.18
R0278:Wapl	UTSW	14	34692612	missense	possibly damaging	0.68
R0335:Wapl	UTSW	14	34692324	missense	probably damaging	0.99
R1018:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R1295:Wapl	UTSW	14	34724769	missense	probably damaging	1.00
R1553:Wapl	UTSW	14	34729190	missense	probably damaging	1.00
R1868:Wapl	UTSW	14	34692458	missense	probably benign	0.00
R1909:Wapl	UTSW	14	34691912	missense	probably damaging	1.00
R2698:Wapl	UTSW	14	34691777	missense	probably benign
R2990:Wapl	UTSW	14	34736708	missense	probably damaging	0.98
R3121:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3122:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3147:Wapl	UTSW	14	34725149	missense	probably damaging	1.00
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3733:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3878:Wapl	UTSW	14	34692147	missense	probably damaging	1.00
R4034:Wapl	UTSW	14	34737914	missense	possibly damaging	0.92
R4934:Wapl	UTSW	14	34692095	missense	probably benign	0.11
R5079:Wapl	UTSW	14	34724757	missense	probably damaging	1.00
R5104:Wapl	UTSW	14	34692059	nonsense	probably null
R5113:Wapl	UTSW	14	34724754	missense	probably damaging	1.00
R5121:Wapl	UTSW	14	34677162	missense	probably benign	0.01
R5299:Wapl	UTSW	14	34733808	critical splice donor site	probably null
R5387:Wapl	UTSW	14	34677295	missense	probably benign	0.00
R5541:Wapl	UTSW	14	34730662	critical splice donor site	probably null
R5618:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R5802:Wapl	UTSW	14	34692320	missense	probably damaging	1.00
R6029:Wapl	UTSW	14	34739247	missense	possibly damaging	0.94
R6292:Wapl	UTSW	14	34729195	missense	probably damaging	1.00
R6482:Wapl	UTSW	14	34692692	missense	probably benign	0.01
R6487:Wapl	UTSW	14	34692292	missense	probably damaging	1.00
R6925:Wapl	UTSW	14	34677363	missense	probably benign	0.31
R6937:Wapl	UTSW	14	34722354	missense	probably benign	0.01
R7080:Wapl	UTSW	14	34692356	missense	probably benign	0.03
R7203:Wapl	UTSW	14	34736691	missense	probably benign
R7944:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7945:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7969:Wapl	UTSW	14	34730647	missense	probably damaging	1.00
R8038:Wapl	UTSW	14	34691682	missense	probably benign
R8053:Wapl	UTSW	14	34692321	missense	probably damaging	1.00
R8688:Wapl	UTSW	14	34692592	missense	possibly damaging	0.94
R8864:Wapl	UTSW	14	34692202	missense	probably benign	0.03
R8988:Wapl	UTSW	14	34729182	missense	probably damaging	1.00
R9072:Wapl	UTSW	14	34677460	missense	possibly damaging	0.81
R9197:Wapl	UTSW	14	34722287	missense	probably damaging	1.00
R9259:Wapl	UTSW	14	34741095	missense	probably benign	0.00
R9545:Wapl	UTSW	14	34677093	missense	probably damaging	1.00
R9613:Wapl	UTSW	14	34731563	missense	probably benign	0.29
R9624:Wapl	UTSW	14	34692106	missense	possibly damaging	0.89
Z1177:Wapl	UTSW	14	34745690	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- AACACGTTTGTTTTGTGAGCCC -3'
(R):5'- AGTAGCTTATGACTATAGGAGCAAG -3'

Sequencing Primer
(F):5'- CGCCTCTATAGTGGGGACTGTAAAC -3'
(R):5'- ACAGAATAGCTTATCTGCAAATGC -3'

Posted On

2016-07-22