Incidental Mutation 'R5222:Wapl'
List |< first << previous [record 51 of 51]
ID402385
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene NameWAPL cohesin release factor
SynonymsA530089A20Rik, Wapal
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34673928-34747983 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 34736685 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 901 (C901*)
Ref Sequence ENSEMBL: ENSMUSP00000130547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
Predicted Effect probably null
Transcript: ENSMUST00000048263
AA Change: C901*
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: C901*

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090027
AA Change: C895*
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: C895*

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect probably null
Transcript: ENSMUST00000151285
AA Change: C185*
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: C185*

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169910
AA Change: C901*
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: C901*

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174559
SMART Domains Protein: ENSMUSP00000133779
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
Pfam:WAPL 1 55 8.6e-22 PFAM
low complexity region 64 79 N/A INTRINSIC
coiled coil region 119 141 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R7944:Wapl UTSW 14 34677148 missense probably benign 0.00
R7945:Wapl UTSW 14 34677148 missense probably benign 0.00
R7969:Wapl UTSW 14 34730647 missense probably damaging 1.00
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- AACACGTTTGTTTTGTGAGCCC -3'
(R):5'- AGTAGCTTATGACTATAGGAGCAAG -3'

Sequencing Primer
(F):5'- CGCCTCTATAGTGGGGACTGTAAAC -3'
(R):5'- ACAGAATAGCTTATCTGCAAATGC -3'
Posted On2016-07-22