Incidental Mutation 'R5222:Angpt1'
List |< first << previous [record 3 of 51] next >> last >|
ID402387
Institutional Source Beutler Lab
Gene Symbol Angpt1
Ensembl Gene ENSMUSG00000022309
Gene Nameangiopoietin 1
SynonymsAngiopoietin-1, 1110046O21Rik, Ang-1, ang1
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location42424723-42676977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42676334 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 43 (Y43C)
Ref Sequence ENSEMBL: ENSMUSP00000022921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022921]
Predicted Effect probably damaging
Transcript: ENSMUST00000022921
AA Change: Y43C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022921
Gene: ENSMUSG00000022309
AA Change: Y43C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 194 254 N/A INTRINSIC
FBG 281 496 3.04e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228544
Meta Mutation Damage Score 0.7189 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a secreted glycoprotein that belongs to the angiopoietin family of vascular growth factors. The encoded protein is a ligand in the vascular tyrosine kinase signaling pathway and regulates the formation and stabilization of blood vessels. This protein also functions in striated muscles by promoting proliferation, migration and differentiation of skeletal myoblasts and plays an essential role in the vascular response to tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality by E12.5 and deficits in vascular development such as a reduction in vascular branching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Angpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Angpt1 APN 15 42476467 missense possibly damaging 0.73
IGL02671:Angpt1 APN 15 42676394 missense possibly damaging 0.79
IGL02876:Angpt1 APN 15 42426977 missense possibly damaging 0.68
IGL03077:Angpt1 APN 15 42476422 nonsense probably null
IGL03334:Angpt1 APN 15 42496412 missense possibly damaging 0.94
R0226:Angpt1 UTSW 15 42468235 missense probably benign 0.01
R1774:Angpt1 UTSW 15 42523616 missense probably damaging 0.99
R1800:Angpt1 UTSW 15 42512404 missense probably damaging 0.96
R1967:Angpt1 UTSW 15 42438307 missense probably damaging 1.00
R4093:Angpt1 UTSW 15 42523545 missense probably damaging 1.00
R4477:Angpt1 UTSW 15 42468164 missense probably damaging 1.00
R4629:Angpt1 UTSW 15 42438400 missense probably benign 0.01
R4647:Angpt1 UTSW 15 42676184 missense probably benign 0.02
R4648:Angpt1 UTSW 15 42676184 missense probably benign 0.02
R4750:Angpt1 UTSW 15 42676401 missense probably benign 0.00
R5386:Angpt1 UTSW 15 42438365 missense probably damaging 1.00
R5457:Angpt1 UTSW 15 42523520 missense probably damaging 1.00
R5526:Angpt1 UTSW 15 42512341 missense probably damaging 1.00
R6154:Angpt1 UTSW 15 42523655 missense probably damaging 1.00
R6904:Angpt1 UTSW 15 42459740 missense probably benign 0.00
R7009:Angpt1 UTSW 15 42523595 missense possibly damaging 0.83
R7101:Angpt1 UTSW 15 42523569 missense probably benign 0.18
R7139:Angpt1 UTSW 15 42676351 missense probably damaging 1.00
R7234:Angpt1 UTSW 15 42459725 missense probably benign 0.25
R7830:Angpt1 UTSW 15 42676268 missense probably damaging 1.00
R8046:Angpt1 UTSW 15 42496356 missense probably benign 0.00
R8073:Angpt1 UTSW 15 42438303 missense probably benign 0.00
R8093:Angpt1 UTSW 15 42476477 missense probably benign 0.01
R8331:Angpt1 UTSW 15 42676257 missense probably damaging 1.00
R8391:Angpt1 UTSW 15 42512398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGAGCAATTAGAAACCG -3'
(R):5'- ACGCTTTCTTTAACGGGGAAAG -3'

Sequencing Primer
(F):5'- CGAAAGCGATCACTTACTTTTTGCAG -3'
(R):5'- TTCTTTAACGGGGAAAGAGTCAAAC -3'
Posted On2016-07-22