Incidental Mutation 'R5222:Or2l13'
ID 402388
Institutional Source Beutler Lab
Gene Symbol Or2l13
Ensembl Gene ENSMUSG00000056822
Gene Name olfactory receptor family 2 subfamily L member 13
Synonyms MOR270-1, GA_x54KRFPKG5P-15934912-15935850, Olfr166
MMRRC Submission 042795-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R5222 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 19305590-19306528 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 19305680 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 31 (I31L)
Ref Sequence ENSEMBL: ENSMUSP00000150764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074739] [ENSMUST00000213531] [ENSMUST00000216465]
AlphaFold Q8VGX2
Predicted Effect probably benign
Transcript: ENSMUST00000074739
AA Change: I31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074299
Gene: ENSMUSG00000056822
AA Change: I31L

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
Pfam:7tm_4 30 306 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 295 3.6e-7 PFAM
Pfam:7tm_1 40 289 2.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213531
AA Change: I31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216465
AA Change: I31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0814 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 159,872,178 (GRCm39) noncoding transcript Het
Acad11 G A 9: 103,974,576 (GRCm39) A515T probably damaging Het
Angpt1 T C 15: 42,539,730 (GRCm39) Y43C probably damaging Het
Arhgef33 A G 17: 80,644,743 (GRCm39) Y24C probably damaging Het
Cd40 G C 2: 164,908,464 (GRCm39) S180T probably benign Het
Cenpc1 A T 5: 86,185,606 (GRCm39) S302T possibly damaging Het
Cit C A 5: 116,090,602 (GRCm39) T932K probably benign Het
Col19a1 A C 1: 24,598,721 (GRCm39) probably null Het
Dapk3 A G 10: 81,028,294 (GRCm39) E288G probably damaging Het
Ddx60 T C 8: 62,437,192 (GRCm39) F1002S probably damaging Het
Dgke G T 11: 88,941,220 (GRCm39) T321K probably benign Het
Ebf2 T G 14: 67,551,043 (GRCm39) probably benign Het
Enpp7 A G 11: 118,881,788 (GRCm39) D311G probably benign Het
Epm2a A G 10: 11,324,493 (GRCm39) E194G probably damaging Het
Esf1 A G 2: 140,000,503 (GRCm39) Y428H possibly damaging Het
Esyt2 T C 12: 116,282,446 (GRCm39) F132S probably damaging Het
Gm5455 T C 13: 110,441,494 (GRCm39) noncoding transcript Het
Gria1 T A 11: 57,080,623 (GRCm39) V202E probably benign Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Mark1 A T 1: 184,660,288 (GRCm39) F123I probably damaging Het
Nectin4 T A 1: 171,212,825 (GRCm39) probably null Het
Obscn T A 11: 58,934,971 (GRCm39) T5220S possibly damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2p2 T A 13: 21,256,739 (GRCm39) H244L probably damaging Het
Pdcd1 A T 1: 93,980,175 (GRCm39) V14E probably damaging Het
Pmel A G 10: 128,554,853 (GRCm39) probably null Het
Pramel28 T A 4: 143,691,362 (GRCm39) I454F possibly damaging Het
Prrx1 C T 1: 163,089,542 (GRCm39) R95Q probably damaging Het
Pstpip2 T A 18: 77,962,032 (GRCm39) Y267* probably null Het
Ptprq A G 10: 107,498,425 (GRCm39) I884T probably damaging Het
Rad17 G A 13: 100,770,399 (GRCm39) T216I possibly damaging Het
Rif1 T C 2: 51,967,032 (GRCm39) I107T probably benign Het
Rpp14 T C 14: 8,087,513 (GRCm38) L69P probably damaging Het
Rtel1 G T 2: 180,988,776 (GRCm39) probably benign Het
Sap130 C T 18: 31,799,756 (GRCm39) T362M probably damaging Het
Scn11a A G 9: 119,644,268 (GRCm39) probably null Het
Sec31a G T 5: 100,530,754 (GRCm39) T243N probably benign Het
Slc5a9 T A 4: 111,755,808 (GRCm39) H30L possibly damaging Het
Slco6b1 T A 1: 96,925,216 (GRCm39) noncoding transcript Het
Smarca4 A G 9: 21,567,002 (GRCm39) D694G probably benign Het
Spaca6 A G 17: 18,058,367 (GRCm39) T213A probably benign Het
Tagap C A 17: 8,152,473 (GRCm39) Q553K possibly damaging Het
Tagap A T 17: 8,152,474 (GRCm39) Q553L possibly damaging Het
Tcf7l2 A G 19: 55,887,044 (GRCm39) Q19R probably benign Het
Ttn A G 2: 76,709,197 (GRCm39) probably benign Het
Ubr7 A T 12: 102,741,964 (GRCm39) R399S probably benign Het
Uspl1 C A 5: 149,150,911 (GRCm39) Q690K possibly damaging Het
Vps8 T A 16: 21,400,298 (GRCm39) Y853* probably null Het
Vrk3 A T 7: 44,409,220 (GRCm39) Q129L possibly damaging Het
Wapl T A 14: 34,458,642 (GRCm39) C901* probably null Het
Other mutations in Or2l13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Or2l13 APN 16 19,306,209 (GRCm39) missense probably benign 0.13
IGL01639:Or2l13 APN 16 19,305,914 (GRCm39) missense probably damaging 0.97
IGL02105:Or2l13 APN 16 19,306,011 (GRCm39) missense probably benign 0.15
IGL02352:Or2l13 APN 16 19,305,927 (GRCm39) missense probably damaging 1.00
IGL02359:Or2l13 APN 16 19,305,927 (GRCm39) missense probably damaging 1.00
IGL03053:Or2l13 APN 16 19,305,969 (GRCm39) missense probably benign 0.36
IGL03168:Or2l13 APN 16 19,305,969 (GRCm39) missense probably benign 0.36
R0576:Or2l13 UTSW 16 19,305,938 (GRCm39) missense probably damaging 1.00
R0920:Or2l13 UTSW 16 19,305,680 (GRCm39) missense probably benign 0.00
R1335:Or2l13 UTSW 16 19,305,803 (GRCm39) missense probably benign 0.01
R1468:Or2l13 UTSW 16 19,306,378 (GRCm39) missense probably benign 0.15
R1468:Or2l13 UTSW 16 19,306,378 (GRCm39) missense probably benign 0.15
R1490:Or2l13 UTSW 16 19,305,672 (GRCm39) missense probably benign
R2095:Or2l13 UTSW 16 19,305,681 (GRCm39) missense probably benign
R3123:Or2l13 UTSW 16 19,305,765 (GRCm39) missense probably damaging 1.00
R4893:Or2l13 UTSW 16 19,305,653 (GRCm39) missense probably benign
R5093:Or2l13 UTSW 16 19,306,227 (GRCm39) missense probably damaging 1.00
R7149:Or2l13 UTSW 16 19,306,260 (GRCm39) missense probably damaging 1.00
R7305:Or2l13 UTSW 16 19,306,449 (GRCm39) missense probably damaging 0.98
R7484:Or2l13 UTSW 16 19,305,753 (GRCm39) missense possibly damaging 0.82
R9394:Or2l13 UTSW 16 19,306,421 (GRCm39) missense possibly damaging 0.66
R9640:Or2l13 UTSW 16 19,305,761 (GRCm39) missense probably damaging 1.00
R9749:Or2l13 UTSW 16 19,306,113 (GRCm39) missense possibly damaging 0.95
X0020:Or2l13 UTSW 16 19,305,840 (GRCm39) missense probably benign 0.22
Z1088:Or2l13 UTSW 16 19,305,798 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CATTTCAGTACAAGTGAGTTCCTC -3'
(R):5'- AGAAGGATTGCACTCCACAGC -3'

Sequencing Primer
(F):5'- CAGTACAAGTGAGTTCCTCTTTATTC -3'
(R):5'- AAAGAGATGCTTTTCTGGCCAG -3'
Posted On 2016-07-22