Incidental Mutation 'R5222:Olfr166'
ID402388
Institutional Source Beutler Lab
Gene Symbol Olfr166
Ensembl Gene ENSMUSG00000056822
Gene Nameolfactory receptor 166
SynonymsGA_x54KRFPKG5P-15934912-15935850, MOR270-1
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19483694-19489882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 19486930 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 31 (I31L)
Ref Sequence ENSEMBL: ENSMUSP00000150764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074739] [ENSMUST00000213531] [ENSMUST00000216465]
Predicted Effect probably benign
Transcript: ENSMUST00000074739
AA Change: I31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074299
Gene: ENSMUSG00000056822
AA Change: I31L

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
Pfam:7tm_4 30 306 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 295 3.6e-7 PFAM
Pfam:7tm_1 40 289 2.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213531
AA Change: I31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216465
AA Change: I31L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0814 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Olfr166
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Olfr166 APN 16 19487459 missense probably benign 0.13
IGL01639:Olfr166 APN 16 19487164 missense probably damaging 0.97
IGL02105:Olfr166 APN 16 19487261 missense probably benign 0.15
IGL02352:Olfr166 APN 16 19487177 missense probably damaging 1.00
IGL02359:Olfr166 APN 16 19487177 missense probably damaging 1.00
IGL03053:Olfr166 APN 16 19487219 missense probably benign 0.36
IGL03168:Olfr166 APN 16 19487219 missense probably benign 0.36
R0576:Olfr166 UTSW 16 19487188 missense probably damaging 1.00
R0920:Olfr166 UTSW 16 19486930 missense probably benign 0.00
R1335:Olfr166 UTSW 16 19487053 missense probably benign 0.01
R1468:Olfr166 UTSW 16 19487628 missense probably benign 0.15
R1468:Olfr166 UTSW 16 19487628 missense probably benign 0.15
R1490:Olfr166 UTSW 16 19486922 missense probably benign
R2095:Olfr166 UTSW 16 19486931 missense probably benign
R3123:Olfr166 UTSW 16 19487015 missense probably damaging 1.00
R4893:Olfr166 UTSW 16 19486903 missense probably benign
R5093:Olfr166 UTSW 16 19487477 missense probably damaging 1.00
R7149:Olfr166 UTSW 16 19487510 missense probably damaging 1.00
R7305:Olfr166 UTSW 16 19487699 missense probably damaging 0.98
R7484:Olfr166 UTSW 16 19487003 missense possibly damaging 0.82
X0020:Olfr166 UTSW 16 19487090 missense probably benign 0.22
Z1088:Olfr166 UTSW 16 19487048 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CATTTCAGTACAAGTGAGTTCCTC -3'
(R):5'- AGAAGGATTGCACTCCACAGC -3'

Sequencing Primer
(F):5'- CAGTACAAGTGAGTTCCTCTTTATTC -3'
(R):5'- AAAGAGATGCTTTTCTGGCCAG -3'
Posted On2016-07-22