Incidental Mutation 'R0415:Pcsk6'
ID 40239
Institutional Source Beutler Lab
Gene Symbol Pcsk6
Ensembl Gene ENSMUSG00000030513
Gene Name proprotein convertase subtilisin/kexin type 6
Synonyms PACE4, SPC4
MMRRC Submission 038617-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.351) question?
Stock # R0415 (G1)
Quality Score 88
Status Validated
Chromosome 7
Chromosomal Location 65861734-66050386 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66033874 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 746 (R746C)
Ref Sequence ENSEMBL: ENSMUSP00000095992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055576] [ENSMUST00000098391] [ENSMUST00000176209]
AlphaFold F6XJP7
Predicted Effect probably damaging
Transcript: ENSMUST00000055576
AA Change: R759C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053742
Gene: ENSMUSG00000030513
AA Change: R759C

DomainStartEndE-ValueType
signal peptide 1 54 N/A INTRINSIC
Pfam:S8_pro-domain 65 141 3.1e-29 PFAM
Pfam:Peptidase_S8 186 469 5.2e-49 PFAM
Pfam:P_proprotein 529 619 9.7e-37 PFAM
FU 682 729 5.87e-11 SMART
EGF_like 688 737 5.03e1 SMART
FU 733 780 4.35e-14 SMART
EGF_like 738 771 3.57e1 SMART
FU 784 828 2.08e-11 SMART
EGF 789 819 2.48e1 SMART
FU 832 877 9.4e-10 SMART
EGF_like 837 868 6.28e1 SMART
FU 885 933 8.58e-4 SMART
EGF 890 920 1.69e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098391
AA Change: R746C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095992
Gene: ENSMUSG00000030513
AA Change: R746C

DomainStartEndE-ValueType
signal peptide 1 54 N/A INTRINSIC
PDB:1KN6|A 62 129 2e-6 PDB
low complexity region 131 144 N/A INTRINSIC
Pfam:Peptidase_S8 190 478 1.1e-58 PFAM
Pfam:P_proprotein 529 619 4.5e-37 PFAM
FU 669 716 3.87e-11 SMART
EGF_like 675 724 5.03e1 SMART
FU 720 767 4.35e-14 SMART
EGF_like 725 758 3.57e1 SMART
FU 771 815 2.08e-11 SMART
EGF 776 806 2.48e1 SMART
FU 819 864 9.4e-10 SMART
EGF_like 824 855 6.28e1 SMART
FU 872 920 8.58e-4 SMART
EGF 877 907 1.69e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176209
AA Change: R598C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135033
Gene: ENSMUSG00000030513
AA Change: R598C

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:Peptidase_S8 103 372 6.5e-50 PFAM
Pfam:P_proprotein 368 458 6.2e-37 PFAM
FU 521 568 5.87e-11 SMART
EGF_like 527 576 5.03e1 SMART
FU 572 619 4.35e-14 SMART
EGF_like 577 610 3.57e1 SMART
FU 623 667 2.08e-11 SMART
EGF 628 658 2.48e1 SMART
FU 671 716 9.4e-10 SMART
EGF_like 676 707 6.28e1 SMART
FU 724 772 8.58e-4 SMART
EGF 729 759 1.69e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177272
Meta Mutation Damage Score 0.2479 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality by E15.5. Embryos develop situs ambiguus with left pulmonary isomerism or craniofacial malformations including cyclopia, or both. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 23,831,050 (GRCm38) noncoding transcript Het
Acox2 A G 14: 8,243,835 (GRCm38) probably benign Het
Adgb T C 10: 10,431,067 (GRCm38) probably null Het
Adgra3 C A 5: 49,961,757 (GRCm38) probably benign Het
Adgre4 G A 17: 55,852,288 (GRCm38) V658I probably benign Het
Ahnak A G 19: 9,012,871 (GRCm38) probably benign Het
Anapc2 A G 2: 25,278,325 (GRCm38) T159A probably damaging Het
Arfgef3 A G 10: 18,613,127 (GRCm38) probably benign Het
Atf7ip C T 6: 136,560,012 (GRCm38) S81L possibly damaging Het
Cacna1i A G 15: 80,368,830 (GRCm38) probably benign Het
Camk1 A T 6: 113,341,891 (GRCm38) Y20* probably null Het
Ccdc40 T C 11: 119,232,118 (GRCm38) Y249H possibly damaging Het
Cd109 T A 9: 78,712,615 (GRCm38) S1380T probably benign Het
Cfap57 A T 4: 118,569,431 (GRCm38) L1107Q possibly damaging Het
Col6a4 C T 9: 106,075,080 (GRCm38) V540I probably damaging Het
Cst9 T A 2: 148,838,442 (GRCm38) probably benign Het
Cul5 C T 9: 53,667,070 (GRCm38) V73I probably benign Het
Cxcl16 T A 11: 70,458,748 (GRCm38) K84* probably null Het
Cyp2c29 T C 19: 39,329,095 (GRCm38) probably benign Het
D6Ertd527e C G 6: 87,111,524 (GRCm38) T223S unknown Het
Dip2c C T 13: 9,568,289 (GRCm38) probably benign Het
Dis3 A T 14: 99,087,456 (GRCm38) I513N probably damaging Het
Dnajc16 A T 4: 141,789,048 (GRCm38) L3* probably null Het
Dop1a T A 9: 86,506,502 (GRCm38) L480M probably damaging Het
Eml6 A G 11: 29,749,392 (GRCm38) V1787A possibly damaging Het
Etnk1 A G 6: 143,180,774 (GRCm38) N115S probably damaging Het
Fryl T C 5: 73,098,414 (GRCm38) Y758C probably damaging Het
Gbp4 G A 5: 105,121,106 (GRCm38) R394C possibly damaging Het
Ggnbp2 A C 11: 84,833,225 (GRCm38) probably benign Het
Gm7137 A G 10: 77,788,173 (GRCm38) probably benign Het
Gstm2 T A 3: 107,984,006 (GRCm38) Q132L probably benign Het
Habp2 T C 19: 56,317,717 (GRCm38) probably benign Het
Hectd2 T C 19: 36,584,884 (GRCm38) probably benign Het
Htr6 A G 4: 139,062,081 (GRCm38) I291T possibly damaging Het
Ighg2c T C 12: 113,287,910 (GRCm38) D199G unknown Het
Itih2 A G 2: 10,105,615 (GRCm38) probably benign Het
Kcnab2 A G 4: 152,395,136 (GRCm38) F248S probably benign Het
Kcnc4 T C 3: 107,445,433 (GRCm38) K610E probably damaging Het
Kcnk16 T A 14: 20,262,975 (GRCm38) probably null Het
Kndc1 C T 7: 139,930,124 (GRCm38) T1293I probably damaging Het
Lcp1 A T 14: 75,227,006 (GRCm38) I556F possibly damaging Het
Lrrc8d T C 5: 105,811,865 (GRCm38) L47P probably damaging Het
Lyset T A 12: 102,744,876 (GRCm38) Y119* probably null Het
Lyst T C 13: 13,711,610 (GRCm38) probably benign Het
Macrod2 G A 2: 142,210,145 (GRCm38) probably null Het
Micalcl C T 7: 112,381,028 (GRCm38) R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,841,339 (GRCm38) probably benign Het
Msh3 A G 13: 92,346,786 (GRCm38) V283A possibly damaging Het
Nup205 T C 6: 35,214,634 (GRCm38) probably benign Het
Nxpe2 T C 9: 48,326,614 (GRCm38) T114A probably damaging Het
Or51e2 C T 7: 102,742,087 (GRCm38) M305I probably benign Het
Or5m10 A T 2: 85,887,438 (GRCm38) I213F possibly damaging Het
Or5m9 A T 2: 86,047,055 (GRCm38) H191L probably benign Het
Or8c15 A T 9: 38,209,973 (GRCm38) M305L probably benign Het
Or8g2 A G 9: 39,909,983 (GRCm38) Y60C probably damaging Het
Pard3 G A 8: 127,610,566 (GRCm38) G1221D probably damaging Het
Pax5 G A 4: 44,691,886 (GRCm38) A120V probably damaging Het
Pif1 G A 9: 65,588,051 (GRCm38) C81Y probably benign Het
Plcb1 A G 2: 135,337,499 (GRCm38) Y609C probably damaging Het
Plcd4 C A 1: 74,552,097 (GRCm38) S217Y probably damaging Het
Plxna1 G A 6: 89,357,336 (GRCm38) H104Y probably benign Het
Polr2k A G 15: 36,175,456 (GRCm38) Y45C probably damaging Het
Prex1 A G 2: 166,586,699 (GRCm38) probably benign Het
Pth2r A G 1: 65,388,439 (GRCm38) M424V probably benign Het
Pygm A G 19: 6,391,366 (GRCm38) R464G probably benign Het
Rad51c A G 11: 87,397,655 (GRCm38) L234P probably damaging Het
Rnf145 A G 11: 44,525,138 (GRCm38) Y60C probably damaging Het
Rnf167 T C 11: 70,649,699 (GRCm38) I135T probably damaging Het
Rnf213 A T 11: 119,414,469 (GRCm38) I509F probably damaging Het
Ro60 G T 1: 143,760,075 (GRCm38) N444K probably benign Het
Ryr2 T C 13: 11,869,156 (GRCm38) S213G probably damaging Het
Selenbp1 T C 3: 94,936,913 (GRCm38) V27A possibly damaging Het
Selenof T G 3: 144,577,692 (GRCm38) L14R probably damaging Het
Sfswap A T 5: 129,504,126 (GRCm38) D121V probably damaging Het
Slc25a34 C A 4: 141,620,469 (GRCm38) M300I possibly damaging Het
Slc34a3 T G 2: 25,229,110 (GRCm38) T583P probably benign Het
Slc66a3 C A 12: 16,997,710 (GRCm38) probably benign Het
Smg1 C A 7: 118,182,468 (GRCm38) A1199S probably benign Het
Spint1 A G 2: 119,245,615 (GRCm38) T231A probably damaging Het
Sptbn1 A C 11: 30,149,576 (GRCm38) N229K probably damaging Het
Sult2b1 A G 7: 45,730,092 (GRCm38) probably benign Het
Tas2r123 A T 6: 132,847,838 (GRCm38) M233L probably damaging Het
Tbcel C A 9: 42,444,500 (GRCm38) C139F probably benign Het
Thbs2 A C 17: 14,679,973 (GRCm38) S573A probably benign Het
Tmem132c A G 5: 127,563,705 (GRCm38) E980G probably damaging Het
Tmem247 G T 17: 86,922,322 (GRCm38) C197F probably damaging Het
Tmem43 C A 6: 91,482,318 (GRCm38) P257Q probably benign Het
Tmprss13 A G 9: 45,337,132 (GRCm38) probably null Het
Ubr5 T C 15: 37,972,980 (GRCm38) T2626A probably damaging Het
Vmn1r196 T A 13: 22,293,836 (GRCm38) V215D probably damaging Het
Vmn1r22 G T 6: 57,900,332 (GRCm38) T220K probably benign Het
Vmn2r116 G A 17: 23,387,279 (GRCm38) M388I possibly damaging Het
Vmn2r74 A C 7: 85,961,410 (GRCm38) C25G probably damaging Het
Xndc1 T C 7: 102,080,616 (GRCm38) probably benign Het
Zfp282 A G 6: 47,897,881 (GRCm38) D340G probably damaging Het
Zfp282 T A 6: 47,905,053 (GRCm38) I558N possibly damaging Het
Zfp316 T A 5: 143,264,491 (GRCm38) T56S unknown Het
Zfp345 A G 2: 150,474,559 (GRCm38) probably benign Het
Other mutations in Pcsk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Pcsk6 APN 7 65,927,820 (GRCm38) missense probably damaging 1.00
IGL01609:Pcsk6 APN 7 66,035,273 (GRCm38) splice site probably null
IGL01986:Pcsk6 APN 7 65,927,877 (GRCm38) missense probably damaging 1.00
IGL02592:Pcsk6 APN 7 65,969,028 (GRCm38) missense probably damaging 1.00
IGL02720:Pcsk6 APN 7 65,980,247 (GRCm38) nonsense probably null
R0045:Pcsk6 UTSW 7 65,962,928 (GRCm38) missense probably damaging 1.00
R0045:Pcsk6 UTSW 7 65,962,928 (GRCm38) missense probably damaging 1.00
R0053:Pcsk6 UTSW 7 65,983,703 (GRCm38) splice site probably benign
R0053:Pcsk6 UTSW 7 65,983,703 (GRCm38) splice site probably benign
R0103:Pcsk6 UTSW 7 65,929,097 (GRCm38) splice site probably benign
R0103:Pcsk6 UTSW 7 65,929,097 (GRCm38) splice site probably benign
R0119:Pcsk6 UTSW 7 66,039,043 (GRCm38) missense probably benign 0.10
R0299:Pcsk6 UTSW 7 66,039,043 (GRCm38) missense probably benign 0.10
R0496:Pcsk6 UTSW 7 65,927,249 (GRCm38) missense probably benign 0.00
R0518:Pcsk6 UTSW 7 65,980,167 (GRCm38) missense possibly damaging 0.64
R0748:Pcsk6 UTSW 7 66,038,968 (GRCm38) unclassified probably benign
R1456:Pcsk6 UTSW 7 66,043,535 (GRCm38) missense possibly damaging 0.87
R1613:Pcsk6 UTSW 7 65,910,311 (GRCm38) splice site probably benign
R1680:Pcsk6 UTSW 7 66,035,250 (GRCm38) missense probably benign 0.14
R1682:Pcsk6 UTSW 7 65,910,228 (GRCm38) missense probably damaging 1.00
R1987:Pcsk6 UTSW 7 65,927,287 (GRCm38) missense possibly damaging 0.60
R4191:Pcsk6 UTSW 7 66,025,308 (GRCm38) missense probably damaging 0.98
R4193:Pcsk6 UTSW 7 66,025,308 (GRCm38) missense probably damaging 0.98
R4577:Pcsk6 UTSW 7 65,959,266 (GRCm38) nonsense probably null
R4592:Pcsk6 UTSW 7 65,931,732 (GRCm38) missense possibly damaging 0.54
R4687:Pcsk6 UTSW 7 65,983,753 (GRCm38) missense probably damaging 1.00
R4697:Pcsk6 UTSW 7 65,959,241 (GRCm38) missense probably damaging 1.00
R4778:Pcsk6 UTSW 7 65,959,145 (GRCm38) missense probably damaging 1.00
R5065:Pcsk6 UTSW 7 65,910,299 (GRCm38) missense possibly damaging 0.84
R5218:Pcsk6 UTSW 7 66,025,288 (GRCm38) missense probably benign 0.01
R5356:Pcsk6 UTSW 7 65,970,592 (GRCm38) missense probably damaging 1.00
R5427:Pcsk6 UTSW 7 66,033,899 (GRCm38) missense probably benign 0.01
R5589:Pcsk6 UTSW 7 65,929,185 (GRCm38) critical splice donor site probably null
R5637:Pcsk6 UTSW 7 65,968,997 (GRCm38) missense probably damaging 1.00
R5888:Pcsk6 UTSW 7 66,043,624 (GRCm38) missense probably null
R5958:Pcsk6 UTSW 7 66,043,611 (GRCm38) missense probably damaging 1.00
R5997:Pcsk6 UTSW 7 65,959,293 (GRCm38) missense probably damaging 1.00
R6191:Pcsk6 UTSW 7 65,929,127 (GRCm38) missense probably benign 0.19
R6274:Pcsk6 UTSW 7 66,033,844 (GRCm38) missense probably damaging 1.00
R6374:Pcsk6 UTSW 7 65,980,155 (GRCm38) missense possibly damaging 0.80
R6393:Pcsk6 UTSW 7 65,969,014 (GRCm38) missense probably damaging 1.00
R6730:Pcsk6 UTSW 7 65,980,248 (GRCm38) missense probably damaging 1.00
R7205:Pcsk6 UTSW 7 66,025,408 (GRCm38) critical splice donor site probably null
R7493:Pcsk6 UTSW 7 66,043,566 (GRCm38) missense possibly damaging 0.53
R7570:Pcsk6 UTSW 7 66,033,898 (GRCm38) missense probably benign 0.03
R7731:Pcsk6 UTSW 7 66,033,893 (GRCm38) missense probably benign 0.00
R7779:Pcsk6 UTSW 7 66,025,404 (GRCm38) missense probably benign 0.03
R8042:Pcsk6 UTSW 7 65,927,935 (GRCm38) missense possibly damaging 0.87
R8734:Pcsk6 UTSW 7 65,931,733 (GRCm38) missense probably benign 0.06
R8805:Pcsk6 UTSW 7 65,929,143 (GRCm38) missense possibly damaging 0.67
R8987:Pcsk6 UTSW 7 65,927,227 (GRCm38) nonsense probably null
R9276:Pcsk6 UTSW 7 65,910,202 (GRCm38) missense probably damaging 1.00
R9492:Pcsk6 UTSW 7 66,047,598 (GRCm38) missense probably benign 0.02
R9747:Pcsk6 UTSW 7 65,983,722 (GRCm38) missense probably damaging 1.00
Z1177:Pcsk6 UTSW 7 66,033,811 (GRCm38) missense probably damaging 0.99
Z1177:Pcsk6 UTSW 7 65,959,113 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACAAGATCCTTACCTGCCCTTGC -3'
(R):5'- TGCTGAGTGCTGTGACTTCACATCC -3'

Sequencing Primer
(F):5'- TTGCTCCCACAGGAAGTG -3'
(R):5'- CTGGTGCAAGGTTCCACAAAAG -3'
Posted On 2013-05-23