Incidental Mutation 'R5222:Tagap'
ID 402391
Institutional Source Beutler Lab
Gene Symbol Tagap
Ensembl Gene ENSMUSG00000033450
Gene Name T cell activation Rho GTPase activating protein
Synonyms Tcd1, TRD, tcs1, tcs-1, Tcd-1, Tcd1a
MMRRC Submission 042795-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R5222 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 8144832-8153729 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8152474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 553 (Q553L)
Ref Sequence ENSEMBL: ENSMUSP00000047431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036370]
AlphaFold B2RWW0
Predicted Effect possibly damaging
Transcript: ENSMUST00000036370
AA Change: Q553L

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047431
Gene: ENSMUSG00000033450
AA Change: Q553L

DomainStartEndE-ValueType
RhoGAP 98 274 1.16e-35 SMART
low complexity region 350 361 N/A INTRINSIC
low complexity region 459 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160545
Meta Mutation Damage Score 0.1030 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase-activator protein superfamily. The encoded protein may function as a Rho GTPase-activating protein. Alterations in this gene may be associated with several diseases, including rheumatoid arthritis, celiac disease, and multiple sclerosis. Alternate splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 159,872,178 (GRCm39) noncoding transcript Het
Acad11 G A 9: 103,974,576 (GRCm39) A515T probably damaging Het
Angpt1 T C 15: 42,539,730 (GRCm39) Y43C probably damaging Het
Arhgef33 A G 17: 80,644,743 (GRCm39) Y24C probably damaging Het
Cd40 G C 2: 164,908,464 (GRCm39) S180T probably benign Het
Cenpc1 A T 5: 86,185,606 (GRCm39) S302T possibly damaging Het
Cit C A 5: 116,090,602 (GRCm39) T932K probably benign Het
Col19a1 A C 1: 24,598,721 (GRCm39) probably null Het
Dapk3 A G 10: 81,028,294 (GRCm39) E288G probably damaging Het
Ddx60 T C 8: 62,437,192 (GRCm39) F1002S probably damaging Het
Dgke G T 11: 88,941,220 (GRCm39) T321K probably benign Het
Ebf2 T G 14: 67,551,043 (GRCm39) probably benign Het
Enpp7 A G 11: 118,881,788 (GRCm39) D311G probably benign Het
Epm2a A G 10: 11,324,493 (GRCm39) E194G probably damaging Het
Esf1 A G 2: 140,000,503 (GRCm39) Y428H possibly damaging Het
Esyt2 T C 12: 116,282,446 (GRCm39) F132S probably damaging Het
Gm5455 T C 13: 110,441,494 (GRCm39) noncoding transcript Het
Gria1 T A 11: 57,080,623 (GRCm39) V202E probably benign Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Mark1 A T 1: 184,660,288 (GRCm39) F123I probably damaging Het
Nectin4 T A 1: 171,212,825 (GRCm39) probably null Het
Obscn T A 11: 58,934,971 (GRCm39) T5220S possibly damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2l13 A C 16: 19,305,680 (GRCm39) I31L probably benign Het
Or2p2 T A 13: 21,256,739 (GRCm39) H244L probably damaging Het
Pdcd1 A T 1: 93,980,175 (GRCm39) V14E probably damaging Het
Pmel A G 10: 128,554,853 (GRCm39) probably null Het
Pramel28 T A 4: 143,691,362 (GRCm39) I454F possibly damaging Het
Prrx1 C T 1: 163,089,542 (GRCm39) R95Q probably damaging Het
Pstpip2 T A 18: 77,962,032 (GRCm39) Y267* probably null Het
Ptprq A G 10: 107,498,425 (GRCm39) I884T probably damaging Het
Rad17 G A 13: 100,770,399 (GRCm39) T216I possibly damaging Het
Rif1 T C 2: 51,967,032 (GRCm39) I107T probably benign Het
Rpp14 T C 14: 8,087,513 (GRCm38) L69P probably damaging Het
Rtel1 G T 2: 180,988,776 (GRCm39) probably benign Het
Sap130 C T 18: 31,799,756 (GRCm39) T362M probably damaging Het
Scn11a A G 9: 119,644,268 (GRCm39) probably null Het
Sec31a G T 5: 100,530,754 (GRCm39) T243N probably benign Het
Slc5a9 T A 4: 111,755,808 (GRCm39) H30L possibly damaging Het
Slco6b1 T A 1: 96,925,216 (GRCm39) noncoding transcript Het
Smarca4 A G 9: 21,567,002 (GRCm39) D694G probably benign Het
Spaca6 A G 17: 18,058,367 (GRCm39) T213A probably benign Het
Tcf7l2 A G 19: 55,887,044 (GRCm39) Q19R probably benign Het
Ttn A G 2: 76,709,197 (GRCm39) probably benign Het
Ubr7 A T 12: 102,741,964 (GRCm39) R399S probably benign Het
Uspl1 C A 5: 149,150,911 (GRCm39) Q690K possibly damaging Het
Vps8 T A 16: 21,400,298 (GRCm39) Y853* probably null Het
Vrk3 A T 7: 44,409,220 (GRCm39) Q129L possibly damaging Het
Wapl T A 14: 34,458,642 (GRCm39) C901* probably null Het
Other mutations in Tagap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Tagap APN 17 8,151,780 (GRCm39) missense probably benign 0.01
IGL02589:Tagap APN 17 8,152,504 (GRCm39) missense possibly damaging 0.87
BB003:Tagap UTSW 17 8,145,770 (GRCm39) critical splice donor site probably null
BB013:Tagap UTSW 17 8,145,770 (GRCm39) critical splice donor site probably null
R1750:Tagap UTSW 17 8,148,742 (GRCm39) missense probably benign 0.06
R1791:Tagap UTSW 17 8,152,377 (GRCm39) missense probably benign 0.04
R1791:Tagap UTSW 17 8,150,299 (GRCm39) missense probably damaging 1.00
R2509:Tagap UTSW 17 8,147,586 (GRCm39) missense probably benign 0.00
R4093:Tagap UTSW 17 8,148,255 (GRCm39) missense probably damaging 1.00
R4627:Tagap UTSW 17 8,145,773 (GRCm39) splice site probably null
R4747:Tagap UTSW 17 8,151,030 (GRCm39) missense probably benign
R5222:Tagap UTSW 17 8,152,473 (GRCm39) missense possibly damaging 0.61
R5866:Tagap UTSW 17 8,152,285 (GRCm39) missense probably damaging 0.98
R6392:Tagap UTSW 17 8,152,893 (GRCm39) missense probably damaging 0.99
R6638:Tagap UTSW 17 8,145,906 (GRCm39) missense possibly damaging 0.71
R6649:Tagap UTSW 17 8,152,546 (GRCm39) missense probably benign 0.36
R6653:Tagap UTSW 17 8,152,546 (GRCm39) missense probably benign 0.36
R7478:Tagap UTSW 17 8,152,422 (GRCm39) missense possibly damaging 0.87
R7509:Tagap UTSW 17 8,147,568 (GRCm39) missense probably damaging 0.99
R7926:Tagap UTSW 17 8,145,770 (GRCm39) critical splice donor site probably null
R8549:Tagap UTSW 17 8,152,797 (GRCm39) missense probably benign 0.36
R8747:Tagap UTSW 17 8,147,602 (GRCm39) missense probably damaging 1.00
R9103:Tagap UTSW 17 8,152,335 (GRCm39) missense probably benign 0.01
R9106:Tagap UTSW 17 8,150,280 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCACCAGACACCAGAGTTTC -3'
(R):5'- ATACTCCCAACTGTCTGGCC -3'

Sequencing Primer
(F):5'- GACACCAGAGTTTCACAACAAAG -3'
(R):5'- AACTGTCTGGCCACCGTAG -3'
Posted On 2016-07-22