Incidental Mutation 'R5222:Spaca6'
List |< first << previous [record 42 of 51] next >> last >|
ID402392
Institutional Source Beutler Lab
Gene Symbol Spaca6
Ensembl Gene ENSMUSG00000080316
Gene Namesperm acrosome associated 6
SynonymsB230206P06Rik, 4930546H06Rik, Ncrna00085
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location17827158-17843009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17838105 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 213 (T213A)
Ref Sequence ENSEMBL: ENSMUSP00000128732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000139969] [ENSMUST00000150302] [ENSMUST00000172097] [ENSMUST00000226899] [ENSMUST00000228490]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000012759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137228
Predicted Effect probably benign
Transcript: ENSMUST00000139969
SMART Domains Protein: ENSMUSP00000119658
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG 151 186 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150302
Predicted Effect unknown
Transcript: ENSMUST00000154301
AA Change: T32A
SMART Domains Protein: ENSMUSP00000117377
Gene: ENSMUSG00000080316
AA Change: T32A

DomainStartEndE-ValueType
Blast:IG 27 78 2e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155293
Predicted Effect probably benign
Transcript: ENSMUST00000172097
AA Change: T213A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128732
Gene: ENSMUSG00000080316
AA Change: T213A

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IG 171 260 2.08e-1 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179350
Predicted Effect probably benign
Transcript: ENSMUST00000226899
Predicted Effect probably benign
Transcript: ENSMUST00000228490
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion that inactivates this gene exhibit impaired fertilization and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Tcf7l2 A G 19: 55,898,612 Q19R probably benign Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Spaca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Spaca6 APN 17 17831167 missense probably benign 0.41
IGL02630:Spaca6 APN 17 17831089 missense probably damaging 1.00
IGL03010:Spaca6 APN 17 17838405 missense probably benign 0.01
IGL03352:Spaca6 APN 17 17838139 missense probably damaging 1.00
R0021:Spaca6 UTSW 17 17838236 nonsense probably null
R0964:Spaca6 UTSW 17 17838391 missense possibly damaging 0.46
R1941:Spaca6 UTSW 17 17838402 missense probably benign 0.05
R1941:Spaca6 UTSW 17 17838430 missense probably damaging 0.99
R2197:Spaca6 UTSW 17 17836154 critical splice donor site probably null
R2235:Spaca6 UTSW 17 17838245 critical splice donor site probably null
R4602:Spaca6 UTSW 17 17831125 missense probably damaging 0.99
R4645:Spaca6 UTSW 17 17836045 intron probably benign
R4672:Spaca6 UTSW 17 17836743 nonsense probably null
R5044:Spaca6 UTSW 17 17831196 missense probably benign 0.00
R5212:Spaca6 UTSW 17 17838394 missense probably benign 0.01
R5528:Spaca6 UTSW 17 17831082 missense probably benign
R5854:Spaca6 UTSW 17 17831247 nonsense probably null
R6029:Spaca6 UTSW 17 17831196 missense probably benign 0.00
R7041:Spaca6 UTSW 17 17836096 missense probably benign 0.14
R7268:Spaca6 UTSW 17 17832107 missense probably benign 0.09
R8281:Spaca6 UTSW 17 17832059 missense possibly damaging 0.78
Z1177:Spaca6 UTSW 17 17831052 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CCATGCTCAATGTGCATTATGAG -3'
(R):5'- GCTCACAAGTTAGAGAGCGG -3'

Sequencing Primer
(F):5'- CTCAATGTGCATTATGAGTCAGG -3'
(R):5'- CCCGTACCGTTCAGATAAA -3'
Posted On2016-07-22