Incidental Mutation 'R5222:Arhgef33'
ID 402393
Institutional Source Beutler Lab
Gene Symbol Arhgef33
Ensembl Gene ENSMUSG00000054901
Gene Name Rho guanine nucleotide exchange factor 33
Synonyms LOC381112, Gm941
MMRRC Submission 042795-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R5222 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 80614836-80707510 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80644743 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 24 (Y24C)
Ref Sequence ENSEMBL: ENSMUSP00000153224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068175] [ENSMUST00000223878] [ENSMUST00000224391]
AlphaFold Q8BW86
Predicted Effect probably damaging
Transcript: ENSMUST00000068175
AA Change: Y24C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063284
Gene: ENSMUSG00000054901
AA Change: Y24C

DomainStartEndE-ValueType
coiled coil region 64 128 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
Pfam:RhoGEF 277 446 4.7e-16 PFAM
low complexity region 455 473 N/A INTRINSIC
low complexity region 510 520 N/A INTRINSIC
low complexity region 620 629 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223878
AA Change: Y24C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224391
AA Change: Y24C

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 159,872,178 (GRCm39) noncoding transcript Het
Acad11 G A 9: 103,974,576 (GRCm39) A515T probably damaging Het
Angpt1 T C 15: 42,539,730 (GRCm39) Y43C probably damaging Het
Cd40 G C 2: 164,908,464 (GRCm39) S180T probably benign Het
Cenpc1 A T 5: 86,185,606 (GRCm39) S302T possibly damaging Het
Cit C A 5: 116,090,602 (GRCm39) T932K probably benign Het
Col19a1 A C 1: 24,598,721 (GRCm39) probably null Het
Dapk3 A G 10: 81,028,294 (GRCm39) E288G probably damaging Het
Ddx60 T C 8: 62,437,192 (GRCm39) F1002S probably damaging Het
Dgke G T 11: 88,941,220 (GRCm39) T321K probably benign Het
Ebf2 T G 14: 67,551,043 (GRCm39) probably benign Het
Enpp7 A G 11: 118,881,788 (GRCm39) D311G probably benign Het
Epm2a A G 10: 11,324,493 (GRCm39) E194G probably damaging Het
Esf1 A G 2: 140,000,503 (GRCm39) Y428H possibly damaging Het
Esyt2 T C 12: 116,282,446 (GRCm39) F132S probably damaging Het
Gm5455 T C 13: 110,441,494 (GRCm39) noncoding transcript Het
Gria1 T A 11: 57,080,623 (GRCm39) V202E probably benign Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Mark1 A T 1: 184,660,288 (GRCm39) F123I probably damaging Het
Nectin4 T A 1: 171,212,825 (GRCm39) probably null Het
Obscn T A 11: 58,934,971 (GRCm39) T5220S possibly damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2l13 A C 16: 19,305,680 (GRCm39) I31L probably benign Het
Or2p2 T A 13: 21,256,739 (GRCm39) H244L probably damaging Het
Pdcd1 A T 1: 93,980,175 (GRCm39) V14E probably damaging Het
Pmel A G 10: 128,554,853 (GRCm39) probably null Het
Pramel28 T A 4: 143,691,362 (GRCm39) I454F possibly damaging Het
Prrx1 C T 1: 163,089,542 (GRCm39) R95Q probably damaging Het
Pstpip2 T A 18: 77,962,032 (GRCm39) Y267* probably null Het
Ptprq A G 10: 107,498,425 (GRCm39) I884T probably damaging Het
Rad17 G A 13: 100,770,399 (GRCm39) T216I possibly damaging Het
Rif1 T C 2: 51,967,032 (GRCm39) I107T probably benign Het
Rpp14 T C 14: 8,087,513 (GRCm38) L69P probably damaging Het
Rtel1 G T 2: 180,988,776 (GRCm39) probably benign Het
Sap130 C T 18: 31,799,756 (GRCm39) T362M probably damaging Het
Scn11a A G 9: 119,644,268 (GRCm39) probably null Het
Sec31a G T 5: 100,530,754 (GRCm39) T243N probably benign Het
Slc5a9 T A 4: 111,755,808 (GRCm39) H30L possibly damaging Het
Slco6b1 T A 1: 96,925,216 (GRCm39) noncoding transcript Het
Smarca4 A G 9: 21,567,002 (GRCm39) D694G probably benign Het
Spaca6 A G 17: 18,058,367 (GRCm39) T213A probably benign Het
Tagap C A 17: 8,152,473 (GRCm39) Q553K possibly damaging Het
Tagap A T 17: 8,152,474 (GRCm39) Q553L possibly damaging Het
Tcf7l2 A G 19: 55,887,044 (GRCm39) Q19R probably benign Het
Ttn A G 2: 76,709,197 (GRCm39) probably benign Het
Ubr7 A T 12: 102,741,964 (GRCm39) R399S probably benign Het
Uspl1 C A 5: 149,150,911 (GRCm39) Q690K possibly damaging Het
Vps8 T A 16: 21,400,298 (GRCm39) Y853* probably null Het
Vrk3 A T 7: 44,409,220 (GRCm39) Q129L possibly damaging Het
Wapl T A 14: 34,458,642 (GRCm39) C901* probably null Het
Other mutations in Arhgef33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Arhgef33 APN 17 80,675,659 (GRCm39) missense probably benign 0.33
IGL00784:Arhgef33 APN 17 80,675,659 (GRCm39) missense probably benign 0.33
IGL01601:Arhgef33 APN 17 80,655,112 (GRCm39) missense probably damaging 1.00
IGL01647:Arhgef33 APN 17 80,672,695 (GRCm39) splice site probably benign
IGL02654:Arhgef33 APN 17 80,677,740 (GRCm39) missense probably damaging 1.00
IGL02712:Arhgef33 APN 17 80,667,802 (GRCm39) missense probably damaging 1.00
R0195:Arhgef33 UTSW 17 80,688,863 (GRCm39) missense probably damaging 0.96
R0732:Arhgef33 UTSW 17 80,688,783 (GRCm39) missense possibly damaging 0.90
R0834:Arhgef33 UTSW 17 80,655,026 (GRCm39) splice site probably benign
R1144:Arhgef33 UTSW 17 80,662,473 (GRCm39) missense probably benign
R1465:Arhgef33 UTSW 17 80,674,730 (GRCm39) missense possibly damaging 0.88
R1465:Arhgef33 UTSW 17 80,674,730 (GRCm39) missense possibly damaging 0.88
R1513:Arhgef33 UTSW 17 80,678,818 (GRCm39) missense probably benign
R1680:Arhgef33 UTSW 17 80,655,080 (GRCm39) missense probably damaging 0.96
R1696:Arhgef33 UTSW 17 80,656,935 (GRCm39) missense probably damaging 1.00
R1775:Arhgef33 UTSW 17 80,681,172 (GRCm39) missense probably benign 0.05
R2046:Arhgef33 UTSW 17 80,680,895 (GRCm39) missense probably benign 0.08
R3933:Arhgef33 UTSW 17 80,680,749 (GRCm39) missense probably benign 0.01
R4573:Arhgef33 UTSW 17 80,672,711 (GRCm39) missense probably damaging 1.00
R5269:Arhgef33 UTSW 17 80,677,704 (GRCm39) missense probably damaging 1.00
R5933:Arhgef33 UTSW 17 80,644,709 (GRCm39) missense probably benign
R6460:Arhgef33 UTSW 17 80,657,018 (GRCm39) splice site probably null
R7307:Arhgef33 UTSW 17 80,654,549 (GRCm39) critical splice acceptor site probably null
R7594:Arhgef33 UTSW 17 80,677,734 (GRCm39) missense probably damaging 1.00
R7746:Arhgef33 UTSW 17 80,654,549 (GRCm39) critical splice acceptor site probably null
R7895:Arhgef33 UTSW 17 80,680,914 (GRCm39) missense probably benign 0.00
R7956:Arhgef33 UTSW 17 80,662,477 (GRCm39) missense possibly damaging 0.81
R8508:Arhgef33 UTSW 17 80,674,764 (GRCm39) missense probably damaging 1.00
R8688:Arhgef33 UTSW 17 80,680,615 (GRCm39) missense probably damaging 0.96
R8743:Arhgef33 UTSW 17 80,667,882 (GRCm39) critical splice donor site probably null
R8768:Arhgef33 UTSW 17 80,681,148 (GRCm39) missense possibly damaging 0.53
R9322:Arhgef33 UTSW 17 80,677,818 (GRCm39) nonsense probably null
R9349:Arhgef33 UTSW 17 80,644,736 (GRCm39) nonsense probably null
R9625:Arhgef33 UTSW 17 80,654,707 (GRCm39) missense possibly damaging 0.95
R9727:Arhgef33 UTSW 17 80,678,720 (GRCm39) missense probably damaging 1.00
Z1177:Arhgef33 UTSW 17 80,691,659 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGTCACTGCTGCCAAATG -3'
(R):5'- AGAATAACTTTCCTCTGCCAACTC -3'

Sequencing Primer
(F):5'- GGACCCTGCATACTACTT -3'
(R):5'- CTCGTTCTCTCAAAGGTTCAAAACG -3'
Posted On 2016-07-22